IMPLEMENTATION OF PUP 1 GENE BASED MARKERS FOR SCREENING OF DONOR VARIETIES FOR PHOSPHORUS DEFICIENCY TOLERANCE IN RICE

Transcription

1 IMPLEMENTATION OF PUP 1 GENE BASED MARKERS FOR SCREENING OF DONOR VARIETIES FOR PHOSPHORUS DEFICIENCY TOLERANCE IN RICE *Kottearachchi N.S. and Wijesekara U.A.D.S.L. Department of Biotechnology, Faculty of Agriculture and Plantataion Management, Wayamba University of Sri Lanka, Makandura, Gonawila (NWP) *Author for Correspondence ABSTRACT Phosphorus is one of the most unavailable and unaccessible macro nutrients in rice due to its' tight binding to soil minerals. The major quantitative trait locus (QTL), Phosphorus uptake 1 (Pup 1), inherited from rice variety, Kasalath confers efficient usage of phosphorus and is currently considered as one of the promising QTLs for the development of phosphorus deficiency tolerance in rice. This study was conducted to detect the possibility of applying the Pup 1 gene based markers for the phenotypic assessment of Sri Lankan rice varieties on phosphorus deficiency tolerance. Twenty varieties including improved and traditional were genotyped by using Pup 1 K-46 and Pup 1 K-52 markers. Root length, shoot length, root width, root volume, dry weight of root and dry weight of shoot were measured under phosphorus deficient and supplemented soil and hydroponics. The PCR profiles revealed that 15 out of 20 varieties possessed Kasalath type Pup 1 allele while other five varieties were Pup 1 negative genotypes. Except shoot length, all other traits were significantly different between the varieties possessing Pup1 allele and lacking Pup1 allele in soil experiment. Root width and root volume were highly significant (P<0.001) in both soil and hydroponic experiment. The results prove that Pup 1 K-46 and Pup 1 K-52 markers are helpful in detecting phosphorus deficiency tolerance in local rice varieties, thereby useful in selecting parental population in rice breeding programs. Key Words: Oryza Sativa, Phosphorus Deficiency, Pup 1 Locus, Sri Lanka INTRODUCTION Rice (Oryza sativa) is the most important cereal crop in human nutrition in South and South eastern Asia. In present rice industry, researches are focused on developing rice varieties for the efficient usage of soil nutrients in order to reduce the cost of production. Phosphorus (P) is one of the six essential macronutrients (N, P, K, Ca, Mg, and S) required by plants. Phosphorus deficiency is one of the most important abiotic stress factors that limit the rice yield. P deficiency is associated with soils that are highly weathered, acidic and inherently low in P (Hammond et al., 2004). In rice-growing areas most of the soil has high P-fixing capacity thereby making it available only 10-20% of the P supplied as fertilizers to plants and the rest of the P bind with the soil mainly to iron and aluminium forms (Wissuwa et al., 1998). Although deficiency can be reduced by fertilizer application, financial problems and the scarcity of P mineral resource and extremely low utilization efficiency of P fertilizer indicate that applying P fertilizer annually is not the long term solution to the problem. Therefore, development of rice cultivars with an improved tolerance to P deficiency is considered as the best cost-effective solution to this problem. Wissuwa et al., (1998) and Ni et al., (1998) have detected the major QTL Pup 1 in chromosome 12, which improves the plants' uptake and capability to extract higher proportion of fixed P in the soils. Pup1 was identified in a rice population derived from a cross between intolerant Japonica cultivar, Nipponbare and the tolerant Indica landrace, Kasalath (Wissuwa et al., 1998), the Pup1 donor variety. Accordingly, the QTL had explained 78.8% of the total phenotypic variation for phosphorus uptake. Heuer et al., (2009) sequenced the Pup 1 region and confirmed that 278-kbp sequence of Kasalath rice variety was significantly different from the syntenic regions in Nipponbare rice variety due to large insertions or deletions (INDELs) that is directly linked with P deficiency tolerance. 76

2 Root morphological and physiological studies indicated that the Pup 1 gene express in root tissue where it either leads to higher root growth per unit P or improves P uptake per unit root size (Wissuwa et al., 2002). It is reported that the impact of Pup 1 and other QTLs on enhancing yield in P-deficient soil under drought stress is significantly high (Bernier et al., 2009; Venuprasad et al., 2009). Therefore, varieties with Pup 1 locus might contain the morphologically and physiologically favourable root structure for the efficient usage of P uptake. Development of rice cultivars through conventional breeding usually needs many years from initiation to varietal release and it has been a difficult task due to the polygenic nature of most of abiotic stress tolerant traits and linkage dragging that incorporates undesirable traits. Therefore, developing rice varieties with tolerance to P-deficient soil by means of marker-assisted selection would be convenient and cost effective method as it helps to selectively incorporate desired genes or QTLs into the plant by getting rid of undesirable traits. According to Chin et al., (2011) Pup 1 has been successfully introgressed into two irrigated rice varieties, namely IR64 and IR74 and three Indonesian upland varieties, namely Dodokan et al., (2012) have identified four genotypes containing Pup 1, Sahbhagi Dhan, Dagaddeshi, Pynthor and Paijong, adapted to North Eastern and Eastern part of India, as potential donors for rice breeding for P deficiency tolerance. This study was carried out to identify rice genotypes carrying Kasalath type Pup1 locus and to find whether there is association between phenotypic performance on phosphorous deficiency tolerance and Pup1 allele in the genetic backgrounds of Sri Lankan rice. MATERIALS AND METHODS Planting Materials Sri Lankan rice varieties representing improved and traditional were used for this study. Seeds of 20 rice accessions were obtained from the Rice Research and Development Institute, Bathalegoda, Sri Lanka and Plant Genetic Recourses Centre, Gannoruwa, Sri Lanka. PCR Amplification Five seeds from each accession were planted on wetted filter paper in a Petry dish. Genomic DNA was extracted from the leaves of three week- old rice seedlings. PCR reactions were carried out on BioRad (My Cycler TM ) thermal cycler in a final volume of 12 µl containing, 5 µl of DNA sample, 1.5 µl of 10X PCR buffers with 2.5 mm MgCl 2, 1.2 µl of 2.5 mm dntps (Promega, U.S.A.), 1.0 µl of primer (Pup 1 K46 and Pup 1 K 52 separately at the concentration of 20 pmol/µl), and 0.1 µl of 5 u/µl Taq DNA polymerase (Dream Taq, Fermentas) in a thermal profile of initial denaturation (5 min at 95 0 C) followed by 35cycles of denaturation (at 95 0 C for 1 min), annealing (at 58 0 C for 30 sec), extension (at 72 0 C for 1 min) and final extension at 72 0 C for 5 min. PCR procedure was repeated three times for all varieties due to the dominant nature of the marker. Amplified PCR products were electrophoresesed on 1 % agarose gel stained with ethidium bromide. A 100-bp DNA ladder was used as the marker to determine the fragment size. Table 1: DNA sequence of the Pup 1markers (Chin et al., 2010) primer Fragment Sequence Size(bp) F/R Pup 1 K F 5 TGAGATAGCCCGTCAAGATGCT3 R 5 AAGGACCACCATTCCATAGC3 Pup 1 K F 5 ACCGTTCCCAACAGATTCCAT3 F-forward, R-reverse R 5 CCCGTAATAGCAACAACCCAA3 77

3 Assessment of Phenotypic Traits in Phosphorus Deficient and Supplemented Soil For the soil experiment, the above mentioned 20 varieties 5 plants from each variety were grown in a planthouse with natural light conditions for 46 days. Plants were grown in a black polythene pots with the height of 30 cm and diameter of 15 cm, filled with 2.5 kg top soil collected from the field. The average P content of the soil was determined by Olsen method (Olsen et al., 1954). Nitrogen (N; 0.39 g of Urea) at basal stage and potassium (K; 0.2 g of Muriate of Potash) were added to all pots. Phosphorus fertilizer (0.16 g of Triple Super Phosphate) was added only to control pots that were considered as P supplemented treatment. No P was added to the other pots that were considered as P deficient treatment. One plant was grown in one pot. Soil was kept aerobic, but well watered without draining at all times. Six quantitative morphological characters were measured in each plant. Root length (cm), shoot length (cm), root width (cm), root volume (ml), root dry weight (g) and shoot dry weight (g) were measured. Root volume was measured by measuring the spilled content of water. Assessment of Phenotypic Traits in Phosphorus Deficient and Supplemented Hydroponics Above mentioned 20 varieties, 5 plants from each variety were grown for 46 days in hydroponics system in plant house. Plants were grown in a basins filled with 20.25L of Yoshida nutrient solution (Yoshida et al., 1972) with modified P concentration (0 µm KH 2 PO 4 for P deficient and 100 µm KH 2 PO 4 for P supplemented condition). The ph was adjusted to 5 once every 2 days and the solution was changed once a week. Six quantitative morphological characters were measured after 46 days as mentioned in the soil experiment. RESULTS AND DISCUSSION Data Analysis Data were analysed by Pooled-t test using SAS statistical package, Version 9.2 developed by SAS institute Inc., Cary, NC, USA, in Results Genotyping by Pup 1 Markers Pup 1 K-46 and Pup 1 K-52 amplified 505 bp and 523 bp fragments respectively (Figure 1) in 15 rice varieties out of 20 rice accessions tested. Five varieties did not show any amplification, either Pup 1 K-46 or Pup 1 K-52 fragments. Pup1 null varieties were further tested with the SSR markers in chromosome 12 in order to verify the quality of DNA as Pup 1 K-46 and Pup 1 K-52 are not supposed to amplify fragments under null allelic condition due to the dominant nature of the markers. The results confirmed the absence of Kasalath type Pup 1 allele in varieties, Kalinga III, At354, Kaluheenati, Bg359 and Hondarawala (Acc No ) (Table 2). Association between Pup 1 genotype and shoot/ root Traits in Soil Experiment Soil P level determined by Olsen et al., (1954) was found as 78 ppm at the ph level. Significant differences were observed in the root length between Pup1 positive variety group and Pup1 negative variety group in both phosphorous supplemented (P<0.01) and deficient soil (P<0.001) conditions (Table 3). Significant differences were not observed in the shoot length between the Pup 1 positive variety group and Pup 1 negative variety group under both phosphorous supplemented and deficient soil conditions. Significant differences were observed in the root width (P<0.001) and root volume (P<0.001) between the Pup 1 positive variety group and Pup 1 negative rice variety group under phosphorous supplemented and deficient soil conditions. The Pup 1 gene positive group has increased the dry weight of root by 1.7 g under P supplemented condition (P<0.001) and by 0.7 g (P<0.01) under P deficient soil condition. Under both condition although the shoot length was not significant, shoot dry weight was highly significant at P<0.001 level. Pup 1 gene positive variety group has increased the root volume by about 50% when compared with null Pup 1 group (Table 3). The results of the Table 3 is further explained by the Figure 2 photograph that shows the root length, width and volume of Pup 1 negative genotypes comparative to some of Pup 1 positive genotypes. 78

4 Association between Pup 1 Genotype and shoot/ root Traits in Hydroponics In the hydroponic experiment also, a significant association between Pup1 positive group and Pup1 negative group was observed in many of the traits (Table 4). In most of Pup 1 positive genotypes, root length has increased in phosphorous deficient condition than that of phosphorous supplemented hydroponics (Table 4, Figure 3). All five varieties with Pup 1 negative genotypes did not show this particular phenotype and instead they showed decreased root length in phosphorous deficient condition than that of phosphorous supplemented condition. The difference between Pup 1 positive and negative groups on root volume and root width was highly significant in both phosphorous deficient condition and supplemented condition. This phenomenon is clearly shown in Figure 3 that indicates low root volume in Kalinga III, At354, Kaluheenati, Bg359 and Hondarawala comparatively to the most of varieties that contained Kasalath type Pup 1 allele. Discussion The used markers, Pup 1 K-46 and Pup 1 K-52 appeared to be closely related markers, because both markers showed same genotyping pattern. These two markers were selected because they were highly diagnostic for Pup 1 locus inherited from variety, Kasalath. Table 2: Genotypic information at Pup 1 locus in tested rice varieties No Variety Acc. no* Pup 1 K 46 Pup 1 K 52 Origin 1 Suwanda samba Traditional Sri Lankan 2 Hondarawala Traditional Sri Lankan 3 Devereddari Traditional Sri Lankan 4 AT Improved Sri Lankan 5 Hondarawala Traditional Sri Lankan 6 Bg Improved Sri Lankan 7 Basmati Improved Pakistan 8 Bw Improved Sri Lanka 9 Azuzena + + Philippine 10 Bg Improved Sri Lanka 11 Bg Improved Sri Lanka 12 Moroberakan Guinea 13 Bg Improved Sri Lanka 14 Bg Improved Sri Lanka 15 Ld Improved Sri Lanka 16 Kalinga III - - Indian 17 AT Improved Sri Lankan 18 Kaluheenati Traditional Sri Lankan 19 BG Improved Sri Lankan 20 Hondarawala Traditional Sri Lankan *Varieties with accession numbers were obtained from Plant Genetic Resources Centre, Gannoruwa, and Varieties without accession numbers were obtained from Rice Research and Development Institute Bathalegoda. (+) presence of Pup 1(Kasalath type) allele and(-) absence of Pup 1(Kasalath type) allele 79

5 According to the haplotype analysis conducted by Tyagi et al., (2012), in aus-type varieties, Pup 1 is equally present in 80 90% of the upland and lowland/irrigated varieties. Varieties originated in Sri Lanka also belong to aus-sub population and they also exhibited the Pup 1 gene in 75% of the varieties tested. Chin et al., (2010) reported that Pup 1 nearisogenic lines (NILs) developed from Kasalath and Nipponbare population showed significant association between Pup 1 gene and yield/ root related traits. 12 In this study several traditional and modern improved rice varieties were assessed by four root related traits and two shoot related traits under P supplemented and P deficient soil in order to detect weather Kasalath type Pup 1 allele contribute for P deficiency tolerance in varieties from diverse genetic background. When the root width and root volume traits were analysed, it was noted that all individual varieties in Pup 1 negative group, Kalinga III, At354, Kaluheenati, Bg359 and Hondarawala (Acc No ) had produced low root width and low root volume (Figure 3) comparatively to other 15 varieties that contained Pup1 in P deficient condition. In hydroponic system, although there was no significant difference in root length and shoot dry weight between Pup 1 positive and negative groups in P supplemented condition, the difference was highly significant in P deficient condition giving increased root length and increased shoot dry weight. These results imply the fact that Pup 1 gene might possibly interfere in rectifying the deficiencies under starving P condition while the role of Pup 1 gene might be trivial if the P availability is fulfilled. Figure 1: PCR profile generated by Pup 1 positive 12 genotypes Upper bands: Amplified by Pup 1K46 markers, Lower bands: Amplified by Pup 1 K52 marker. Lane X: 100-bp ladder DNA marker, Lane 1-12: Rice varieties from No 1 to No 12 respectively as indicated in the table 2. Figure 2: Root morphology of Pup 1 positive varieties and Pup 1 negative rice varieties assessed in P supplemented soil Abbreviations: 1-5: Pup 1 positive genotypes; 1: Bg 357, 2: Moraberakan, 3: Bg 5-110, 4: Bg 250, 5: LD 250, 6-10: Pup 1 negative genotypes; 6: Kalinga III, 7: AT 354, 8: Kaluheenati, 9: Bg 359, 10:H

6 Table 3: Mean values of root and shoot traits of rice in P supplemented and P deficient condition in soil experiment Field experiment P supplemented P deficient Root length Pup 1+ Shoot length Pup 1+ Root width Pup 1+ Root volume Pup 1+ Root weight Shoot weight dry dry Pup 1+ Pup 1+ Mean T value Mean T value ± ± ± ± ± ± ± ± ± ± ± ± ** ± ± ns ± ± *** 5.04 ± ± *** ± ± *** 1.86 ± ± *** 5.90 ± ± *** ns 3.96 *** 4.89 *** 3.21 ** 4.2 *** * Significant at 0.05 level, ** significant at 0.01 level, *** significant at level and ns not significant Table 4: Mean values of root and shoot traits of rice in P supplemented and P deficient condition in hydroponic experiment Hydroponics experiment P supplemented P deficient Mean T value Mean T value Root length Pup 1+ Shoot length Pup 1+ Root width Pup 1+ Root volume Pup 1+ Root weight Shoot weight dry dry Pup 1+ Pup ± ± ± ± ± ± ± ± ± ± ± ± ns 30.81± ± ns 32.64± ± *** 1.50± ± *** 3.99± ± *** 0.15± ± ns 0.18± ± ** 0.24 ns 6.13 *** 7.65 *** ns 4.36*** * Significant at 0.05 level, ** significant at 0.01 level, *** significant at level and ns not significant 81

7 root width (cm) root volume (ml) root length (cm) Indian Journal of Plant Sciences ISSN: (Online) Hondarawala (+Pup 1) Suwanda samba (+Pup 1) Devereddari (+Pup 1) AT 405(+Pup 1) Bg (+Pup 1) Hondarawala(+Pup 1) Bw 400(+Pup 1) Basmathi 370(+Pup 1) Azuzena (+Pup 1) Bg 352(+Pup 1) Bg 357(+Pup 1) Bg 5-110(+Pup 1) Moroberakan (+Pup 1) Bg 250(+Pup 1) Ld 356(+Pup 1) AT 354(-Pup 1) Kalinga III (-Pup 1) P supplimented P deficient Kaluheenati (-Pup 1) BG 359(-Pup 1) Hondarawala (-Pup 1) Figure 3: Variation of root width, root volume and root length of rice germplasm grown in hydroponics It is well documented fact that the ability of a plant to access phosphorous from soil depends on root physiological and morphological properties such as root length, root volume, root architecture, the spatial configuration of a root system in the soil. As the main organ of plants that take up nutrients, roots play an important role in phosphorous acquisition from soils. In this study root and shoot related traits of Pup 1 positive varieties and Pup 1 negative varieties were analysed by pooling the respective data in order to confirm the general contribution from Pup 1 locus to root and shoot growth. Results revealed that Pup 1 positive genotypes integrate different root traits that contribute to the adaptation to low phosphorous availability and therefore more tolerance to phosphorous deficiency is appeared as compared to Pup 1 negative genotypes. At354, Bg352 are commonly used parents in breeding programs in Sri Lanka. If they are selected as parents when designing breeding programs, it is necessary to consider their null Pup 1 phenotype before deciding their partner parents. Conclusion The results of this study revealed that there is a significant difference between rice variety group with Pup 1 positive genotypes and the variety group with Pup 1 negative genotypes, in root width, root dry weight, root volume and shoot dry weight. Phenotypic data corresponding to Pup 1 genotype have indicated the performance of root traits thereby making them useful in utilizing in breeding programs. 82

8 ACKNOWLEDGEMENT Authors acknowledge Wayamba University of Sri Lanka research grant (SRHDC/RP/01/10-05) and National Science Foundation research grant (RG/2011/BT/02) for financial support. REFERENCES Bernier J, Kumar A, Venuprasad R, Spaner D, Verulkar S, Mandal NP, Sinha PK, Peeraju P, Dongre PR and Mahto RN (2009). Characterization of the effect of a QTL for drought resistance in rice, QTL 12.1, over a range of environments in the Philippines and eastern India. Euphytica Chin JH, Gamuyoo R, Dalid C, Bustamam M, Prasetiyono J, Moeljopawiro S, Wissuwa M and Heuer S (2011). Developing rice with high yield under phosphorus deficiency: Pup 1 sequence to application. Plant Physiology Chin JH, Lu X, Haefele SM, Gamuyao R, Ismail A, Wissuwa M and Heuer S (2010). Development and application of gene-based markers for the major rice QTL Phosphorus uptake 1. Theoretical and Applied Genetics 120(6) Hammond JP, Broadley MR and White PJ (2004). Genetic Responses to Phosphorus Deficiency. Annals of Botany Heuer S, Lu X, Chin JH, Tanaka JP, Kanamori H, Matsumoto T, Deleon T, Ulat VJ, Ismail AM, Yano M and Wissuwa M (2009). Comparative sequence analyses of the major quantitative trait locus phosphorus uptake 1(Pup 1) reveal a complex genetic structure. Plant Biotechnology Journal 7(5) Ni JJ, Wu P, Senadhira D and Huang N (1998). Mapping QTLs for phosphorus deficiency tolerance in rice (Oryza sativa L.). Theoretical and Applied Genetics Olsen SR, Cole CV, Watanabe FS and Dean LA (1954). Estimation of available phosphorus in soils by extraction with sodium bicarbonate. Circular No Tyagi W, Rai M and Dohling A (2012). Haplotype Analysis for locus in rice genotypes of north eastern and eastern India to identify suitable donors tolerant to low phosphorus. Sabrao Journal of Breeding and Genetics 44(2) Venuprasad R, Dalid CO, Delvalle M, Zhao D, Espiritu M, Stacruz T, Amante M, Kumar A and Atlin GN (2009). Identification and characterization of large effect quantitative trait loci for grain yield under lowland drought stress in rice using bulk-segregant analyses. Theoretical and Applied Genetics 120(1) Wissuwa M, Wegner J, Ae N and Yano M (2002). Substitution mapping of Pup 1: A major QTL increasing phosphorus uptake of rice from a phosphorus deficient soil. Theoretical and Applied Genetics Wissuwa M, Yano M and Ae N (1998). Mapping of QTLs for phosphorus-deficiency tolerance in rice (Oryza sativa L.) Theoretical and Applied Genetics