Hu Yin-Gang. State Key Lab of Crop Stress Biology for Arid Areas, Northwest A&F University, September 12,

Size: px

Start display at page:

Download "Hu Yin-Gang. State Key Lab of Crop Stress Biology for Arid Areas, Northwest A&F University, September 12,"

Melvin Barrett
5 years ago
Views:

Key Lab of Crop Stress Biology for Arid Areas, Northwest

1 Utilization of Dwarfing Genes to Improve Drought Tolerance and Yield Potential in Wheat Hu Yin-Gang State Key Lab of Crop Stress Biology for Arid Areas, Northwest A&F University, September 12,

2 Lodging, the most serious risk for wheat production

3 Application of dwarfing genes in wheat Rht-B1b, RhtD1b and Rht8, the most widely used dwarfing genes in wheat.

4 Distribution of dwarfing genes Rht-B1b, Rht-D1b and Rht8 in cultivars of different zones Huang-huai winter wheat zone Northwestern Southwestern Spring wheat winter wheat zone zone Dwarfing gene Northern winter wheat zone Rht-B1b Rht-D1b Rht Rht-B1b+Rht Rht-D1b+Rht No dwarfing gene detected Total Dwarfing genes Rht-B1b and Rht-D1b are mostly utilized in regions, where rainfall was relatively plenty for wheat production or with irrigation; while Rht8 gene has extensive distribution in various ecological regions, where most of the regions are rainfed areas or with limited irrigation.

5 Effects of dwarfing genes on plant height of wheat (cm) Dwarfing gene Plant Effects on shortening height plant height (%) Variation Rht-B1b 80.8c Rht-D1b 74.6c Rht-B1b+Rht8 77.0c Rht-D1b+Rht8 72.7c Rht8 91.9b No dwarfing gene detected 107.2a Note: Significant at p<0.05

6 Effects of dwarfing genes on internode length of wheat (cm) Dwarfing gene 1 st internode 2 nd internode 3 rd internode Rht-B1b 27.2c 19.8bc 11.4c Rht-D1b 25.8c 16.7d 9.9c Rht-B1b+Rht8 24.5c 18.1cd 11.1c Rht-D1b+Rht8 24.9c 17.1d 9.4c Rht8 30.5b 20.5b 14.0b No dwarfing gene detected 35.1a 22.9a 15.9a Note: Significant at p<0.05

7 Tall Rht Rht-B1b Rht-D1b Rht-B1b+Rht8 Rht-D1b+Rht Model for effects of dwarfing genes on plant height and internode length of wheat

8 Test for coleoptile length of wheat cultivars

9 Effects of dwarf genes on coleoptile length Genotype Coleoptile Length (cm) Range (cm) Effects on shortening coleoptile length (%) Rht-B1b 5.0 b Rht-D1b 4.6b Rht-B1b + Rht8 4.8b Rht-D1b + Rht8 4.6b Rht8 6.1a Tall 6.5a GA-insensitive dwarf genes significantly reduce coleoptile length, while GA-responsive dwarf gene Rht8 not.

10 Effects of dwarf genes on yield components of wheat Genotype No. of Spikelets Rht-B1b 21.0a Rht-D1b 21.5a Rht-B1b+Rht8 21.4a Rht-D1b+Rht8 21.5a Rht8 21.3a No dwarfing gene detected 21.2a Range Kernels per spike Range CV(%) 40.0d ab bc abc a c

11 Utilization of GAGA-sensitive dwarfing genes Wheat cultivars with Rht-B1b and RhtD1b (GA insensitive) mainly used in the areas with better water conditions, while those with Rht8 or Tall mainly used in the rainfed conditions. Why? GA responsive dwarfing genes may be better for improving water use efficiency and wheat yield potential?

12 Utilization of GAGA-sensitive Rht genes To evaluate the effects of different GA-responsive dwarfing genes on drought tolerance and yield potential of wheat, the populations and lines with dwarfing genes, Rht12 and Rht13 (GA sensitive) were constructed?

13 Effects of the dwarfing gene Rht12 on wheat (Triticum aestivum L.) F2 population from Ningchun45 Karcagi12. Ningchun45: Vrn-B1; rht12. a Chinese cultivar with spring growth habit. Karcagi12: vrn-b1; Rht12. The genotype of each F2 plant was detected by molecular markers. And only the homology ones (RRBB; RRbb; rrbb; rrbb) were developed into F2:F3 population.

14 Genotyping of Vrn-B1 in the F2 population 杂合 Bb 纯合冬性 bb 纯合春性 BB 750bp 1000bp VrnB: Intr1/B/F, CAA GT GGAACGGT TA GGACA; Intr1/B/R3, CTCA T GCCAAAAA T T GAA GA T GA, target product 709bp. vrnb: Intr1/B/F, CAA GT GGAACGGT TA GGACA; Intr1/B/R4, CAAA T GAAAA GGAA T GA GA GCA, target product 1149bp. (Fu D et al. 2005)

Genotyping of Rht12 in the F2 population 杂合 Rr 纯合矮杆纯合高秆 RR rr 300bp 250bp 180bp Genotyping of Rht12 in the F2 population Rht12 locates in 5AL, dominant dwarf gene,

15 Genotyping of Rht12 in the F2 population 杂合 Rr 纯合矮杆纯合高秆 RR rr 300bp 250bp 180bp Genotyping of Rht12 in the F2 population Rht12 locates in 5AL, dominant dwarf gene, sensitive to GA linked to Xgwm 291 with genetic distance of 5.4 cm (V. KORZUN et al. 1997). PCR primers, F: 5' CATCCCTACGCCACTCTGC 3 ; R: 5' AATGGTATCTATTCCGACCCG 3'

16 Ear Peduncle 51.5cm Internode cm Internode cm Internode cm Internode cm 9.0cm Internode 1 Main culm length (cm) Fig. Schematic representation of internode elongation patterns in the genotypes: RRBB (1), RRbb (2), rrbb (3), rrbb (4) and GA treatment, Rht12, Nchun45 and Rht12 s GA treatment. 16.3cm

17 Spike characters Genotype Spike L Spikelets Kernels Seedset ratio RRBB (1) RRbb (2) rrbb (3) rrbb (4) 1GA 2GA 3GA 4GA Rht12 Nchun a 13.53a 14.64b 13.89ab ab 19.88a 20.71b 19.95ab a 44.6a 41.6b 40.5b a 0.23a 0.21b 0.21b Thousand kernel weight 31.53a 32.57a 43.19b 43.04b Rht12GA Rht12GA RRBB (1), RRbb (2), rrbb (3), rrbb (4) and GA treatment, Rht12, Nchun45, and Rht12 s GA treatment.

18 Yield characters RRBB (1) RRbb (2) rrbb (3) rrbb (4) 1GA 2GA 3GA 4GA Rht12 Nchun45 Grain weight per Biomass per individual individual ab a b ab Rht12GA Rht12GA Genotype Harvest index 0.35a 0.36a 0.31b 0.31b RRBB (1), RRbb (2), rrbb (3), rrbb (4) and GA treatment, Rht12, Nchun45, and Rht12 s GA treatment.

19 1cm Nchun 六叶期 Z19 苗期形态 2 1 Rht12

20 Plant height in different genotypes (cm) Plant height and Spike length of Rht12 (cm)

100 100 40 40 3 3GA 4 4GA 3 3GA 0 0 1 1GA 2

21 GA 4 4GA 3 3GA GA 2 2GA 1GA 1GA Height of the tall and dwarf plants treated with gibberellin (cm) The stem of the GA ones are crooked because of the serious lodging

22 Effects of dwarfing gene Rht13 on DT and yield traits in wheat Rht13 with JM47, FCH3

23 Genetic analysis of Plant height among the three Rht13 populations (in general) Sources of variance Estimation Rate of Vp Significance Additive S** Dominance S** Genotypes S** Phenotypic NS =Not Significant; S+ = Significant at S* = Significant at 0.05; S** = Significant at 0.01.

24 Genetic effects of Rht13 on plant height and other traits among the F2:F3 lines of JM47 X Rht13 Trait Rht13+rht8 rht13+rht8 Rht13+Rht8- rht13+rht8- Plant Height 93.50±13.63bB ±8.97aA 85.64±10.41bB 91.94±3.34bB Peduncle length 25.53±2.83bB 34.13±3.19aA 25.49±4.63bB 22.90±3.79bB 2nd stem length 23.11±4.65bB 27.99±2.42aA 22.59±3.48bB 24.80±1.29bAB 3rd stem length 16.46±2.44ab 18.45±1.91a 15.49±2.52b 17.07±0.91ab

25 Genetic effects of Rht13 on plant height and other traits among the F2:F3 lines of JM47 X Rht13 Trait Rht13+rht8 rht13+rht8 Rht13+Rht8- rht13+rht8- Spike length 10.38±0.52a 10.50±1.20a 9.79±0.79a 10.14±1.07a No. of Spikelets 18.38±1.19a 19.00±1.20a 18.05±1.31a 19.14±1.86a No. of kernels 27.64±2.19bAB 29.96±4.19abA B 26.86±3.73bB 31.84±3.22aA No. of efficient tillers 13.13±2.10a 12.10±2.50a 12.81±2.65a 13.34±2.66a

26 Genetic effects of Rht13 on plant height and other traits among the F2:F3 lines of FCH3 X Rht13 Trait Tall Dwarf Difference Effects(%) Plant height ± ± * Peduncle length 36.90± ± * nd stem length 25.34± ± * rd stem length 17.58± ± * 21.55

27 Genetic effects of Rht13 on plant height and other traits among the F2:F3 lines of FCH3 X Rht13 Trait Tall Dwarf Difference Effects(%) Spike length 9.71± ± ns 1.77 No. of spikelets 17.64± ± ns 5.84 No. of kernels per spike 36.36± ± ns 4.65 No. of efficient tillers 11.32± ± ns 10.95

Scientific Fund, NWAFU(ZD2012002) ACIAR(CIM2005-111),

28 Supported by funding from: 863 Plan, Ministry of Sci-Tech, PRC The key project of Chinese Universities Scientific Fund, NWAFU(ZD ) ACIAR(CIM ), Australia 111 Plan, Ministry of Education, PRC Thanks for your attention!

29 The China - EU and ACIAR Workshop on Phenotyping for Abiotic Stress Tolerance in Crop Breeding, May 1012, 2013, Yangling, China The EU-China partnership initiative in crop breeding (OPTICHINA) was launched on June, 2011 as a new instrument that may serve as model to reinforce a systematic co-operation on Agricultural Research between Europe and China. The ACIAR project CIM was lauched on July 1, 2008 as a technology innovation and transfer to promote the improvement of water use efficiency in wheat grown in rainfed and limited irrigation conditions.

30 The sections Assessment of photosynthesis related characters in crops Characterization of developmental and growth characters in crops Assessment of drought tolerance and water use efficiency in crops Novel high throughout phenotyping technologies and their application

31 Local supporters College of Agronomy, Northwest A & F University State Key Lab of Crop Stress Biology in Arid Areas (NWAFU) The Institute of Water Saving Agriculture in Arid Areas of China

32 Institute of Water Saving Agriculture in Arid Areas of China (IWSA), NWAFU Irrigation emitters test lab. Plant root observation facility Rainfall simulation facility Field water transfer monitoring facility (under ground part) Lysimeters for Potted plants field

Effects of Gibberellic Acid Responsive Dwarfing Gene Rht9 on Plant Height and Agronomic Traits in Common Wheat

Effects of Gibberellic Acid Responsive Dwarfing Gene Rht9 on Plant Height and Agronomic Traits in Common Wheat American Journal of Agriculture and Forestry 2017; 5(4): 102-111 http://www.sciencepublishinggroup.com/j/ajaf doi: 10.11648/j.ajaf.20170504.14 ISSN: 2330-8583 (Print); ISSN: 2330-8591 (Online) Effects