Soil Biology & Biochemistry
|
|
- Adrian Manning
- 5 years ago
- Views:
Transcription
1 Soil Biology & Biohemistry 42 (21) 244e252 Contents lists ville t SieneDiret Soil Biology & Biohemistry journl homepge: Erthworms influene the prodution of ove- nd elowground iomss nd the expression of genes involved in ell prolifertion nd stress responses in Aridopsis thlin Ulrike Jn, Séstien Brot, Mnuel Blouin, Ptrik Lvelle, Dniel Lffry, Anne Repellin, * Eophysiologie Moléulire, équipe Intertions Biologiques dns les Sols (IBIOS), UMR 7618 Bioemo Fulté des Sienes et Tehnologie, Université Pris Est - Créteil, 61 venue du Générl de Gulle, F-941 Créteil edex, Frne IRD-Lortoire Bioemo (UMR 7618), Eole Normle Supérieure, 46 rue d'ulm, F-7523 Pris edex 5, Frne IRD-Lortoire Bioemo (UMR 7618), Centre IRD Bondy, 32 rue Henri Vrgnt, F Bondy Cedex, Frne rtile info strt Artile history: Reeived 2 June 29 Reeived in revised form 27 Otoer 29 Aepted 28 Otoer 29 Aville online 14 Novemer 29 Keywords: Aridopsis thlin Aporretode liginos Plnt plstiity Shoot-root rtio Soil qulity Trnsript umultion Erthworm To etter understnd the omplex mehnisms of tion of erthworms on plnts, we set up n experimentl system using the model plnt Aridopsis thlin (L.) Heynh, Aporretode liginos ommon temperte erthworm nd two types of soil with ontrsted ontents in orgni mtter nd nutrients. Chnges in plnt iomss, iomss llotion to roots, leves nd stems nd C/N rtios were relted to vritions in the expression of severl plnt genes involved in ellulr division nd stress responses nd with erthworm-indued ltertions in soil minerl sttus. In the poorest soil, i.e. with low ontents in minerl nutrient nd orgni mtter, erthworms inresed soil nitrte ontent very signifintly nd oosted plnt oveground iomss prodution. This orrelted with hnges in lef trnsript umultion suggesting enhned ell division nd lesser inidene of retive oxygen speies. In the riher soil, erthworms hd no signifint effet on the prodution of eril iomss. However, severl plnt responses were oserved regrdless of soil qulity: enhned umultion of n uxin-responsive trnsript in the leves, strong derese in root length nd iomss nd redution in C/N vlues, prtiulrly in the olt stems. Although these results pointed out erthworm-indued enhnement of minerliztion s determining ftor in the formidle plnt growth responses, the relese in the drilosphere of phytohormone-like ompounds y erthwormtivted teri ws most likely implited s well in this proess nd resulted in fored nitrogen uptke y the plnts. The herein demonstrted sensitivity of the model plnt A. thlin to erthworms shows tht suh new experimentl set up ould eome entrl key to the development of multidisiplinry investigtions on plntesoil intertions. Ó 29 Elsevier Ltd. All rights reserved. 1. Introdution Erthworms re generlly regrded s enefiil to plnt growth (Brown et l., 1999; Sheu, 23). Their mehnisms of tion inlude hnges in soil struture tht ffet root growth nd wter lne (Blnhrt et l., 1999). Erthworms llow plnts to etter resist prsiti nemtode ttks, either y deresing nemtode popultion density (Yetes, 1981; Senpti, 1992), y enhning the pity of plnts to tolerte these prsites (Blouin et l., 25; Lfont et l., 27) or y stimulting miroes tht re ntgonisti to root pthogens (Clpperton et l., 21). Mostly, erthworms re * Corresponding uthor. Tel.: þ33 () ; fx: þ33 () E-mil ddresses: ulrike.jn@lu-internet.fr (U. Jn), sestien.rot@ird.fr (S. Brot), louin@univ-pris12.fr (M. Blouin), lvelle@ird.ondy.fr (P. Lvelle), lffry@univ-pris12.fr (D. Lffry), repellin@univ-pris12.fr (A. Repellin). known to indue hnges in nutrient sptiotemporl vilility (Brois et l., 1999) through frgmenttion nd urying of soil litter (Brown et l., 2) nd miroe-sed minerliztion of soil orgni mtter (Postm-Bluw et l., 26). Aording to some uthors, the ltter leds to the relese of minerl nitrogen essentilly nd represents the mjor mehnism of tion of erthworms responsile for inreses in plnt iomss prodution (Brown et l., 1999). It ould explin how greter enefits on produtivity hve mostly een oserved in poor soils (Brown et l., 24). However, in n experimentl system omining rie plnts nd the erthworm Millsoni noml, inresing the vilility of minerl nutrients did not suppressed the positive effet of the erthworm on plnt growth (Blouin et l., 26). This ment tht other mehnisms thn minerliztion were involved. The stimultion y erthworms of teri produing phytohormone-like ompounds (Krishnmoorthy nd Vjrnhih, 1986) hs een suggested. Auxin-like /$ e see front mtter Ó 29 Elsevier Ltd. All rights reserved. doi:1.116/j.soilio
2 U. Jn et l. / Soil Biology & Biohemistry 42 (21) 244e ompounds hve indeed een identified in erthworm sts (Musolo et l., 1998, 1999). Furthermore, these moleules ppered to e potent meditors of plnt nitrogen metolism sine they systemilly stimulted nitrte trnsport into plnts nd its ssimiltion y plnt ells (Musolo et l., 1999; Cnells et l., 22; Quggiotti et l., 24). Wht emerges from this rpid overview of the literture is tht plnteerthworms reltions re extremely omplex, due to the numer of mehnisms involved, nd the ft tht soil hrteristis, plnt physiology nd erthworm ehviour re likely to influene these mehnisms. As result, effiient ontriutions to their understnding should ddress the physiologil nd moleulr proesses underlying the mrosopi hnges in plnt growth nd morphology oserved in the presene of erthworms. In this ontext, we designed n experimentl set up omining the peregrine endogei erthworm Aporretode liginos (Lee, 1985; Sheu, 23) nd the plnt Aridopsis thlin (L.) Heynh. This plnt speies ws hosen for its vlue s model orgnism extensively studied t oth physiologil nd geneti levels. Its responsiveness to erthworms ws tested here for the first time through nlysis of vritions in C/N rtios nd in root, lef nd seed iomss prodution. At the sme time, the possile effets of erthworms on vrious plnt ell proesses ws exmined t the moleulr physiology level y studying the stedy-stte levels of ICK1, PLD, Cu/Zn SOD, HBT nd RuS gene trnsripts. When overexpressed in Aridopsis plnts, ICK1, whih enodes potent inhiitor of ell yle ylin-dependent protein kinses (CDKs) (Wng et l., 1998; Frnis, 27) indued signifint redution in lef size nd rosette dimeter (Bemis nd Torii, 27). A high ICK1 trnsript level ws therefore onsidered n inditor of poor ell division. HBT protein funtions hve een relted to IAA-regulted ell division nd differentition (Blilou et l., 22). PLD nd Cu/Zn SOD trnsripts oth enode proteins tht re trnsriptionlly responsive to stresses, suh s wounding (Wng, 22) nd exess of retive oxygen speies (Skmoto et l., 1995; Kmink et l., 1999), respetively. They were used here s ell stress inditors. It is noteworthy tht high levels of PLD gene expression hve een oserved in dividing nd growing plnt ells suggesting tht it my ply n essentil role in ell prolifertion (Xu et l., 1997). The RuS trnsripts tht enode the smll su-unit of the riulose 1,5- diphosphte roxylse were studied here to ssess the possile trnsriptionl impt of erthworms on the ron fixing enzyme (Nielsen et l., 1998). Another originl feture of our experimentl system, in ddition to the moleulr nlyses, onsisted in the use of two soils with ontrsting properties: sndy misol nd lyey leptosol, the misol eing muh poorer in minerl nutrients nd orgni mtter thn the leptosol. The ojetive ws to differentite etween two types of plnt responses to erthworms: those medited through nutrient relese nd those relted to other mehnisms of tion. It ws ssumed tht the unoupling etween these response mehnisms would led to the identifition of generl erthworm effets independent of soil qulity. 2. Mterils nd methods 2.1. Soil hrteristis nd miroosms preprtion Soils were olleted from the top lyer (e2 m), t the Museum Ntionl d'histoire Nturelle in Brunoy (Essonne, Frne) nd t the Centre de Reherhe en Eologie Expérimentle et Préditive - CEREEP (Sint-Pierre-Lès-Nemours, Frne). One is lreous leptosol supporting deiduous forest (totl orgni ron ontent, 56.7 g kg 1 ; totl nitrogen ontent, 4.65 g kg 1 ; ph, 7.45; CEC, 23.4 mol kg 1 ) with lomy texture (34.4% ly, 39.2% silt, 27.4% snd). The seond soil, muh poorer thn the other one, is misol supporting nturl medow (totl orgni ron ontent, 14.7 g kg 1 ; totl nitrogen ontent, 1.19 g kg 1 ; ph, 5.22; CEC, 4.8 mol kg 1 ) with sndy texture (6.9% ly, 19.% silt, 74.1% snd). The leptosol nd misol olleted will herefter e referred to s rih (R) nd poor (P) soils, respetively. Both soil smples were dried t 25 C for week, pssed through 2 mm mesh sieve nd used to prepre miroosms. These growth units onsisted in 1 m dimeter, 16 m-high pots filled with.9 kg or 1.3 kg of the rih or poor soil, respetively, to oupy similr volumes in the pots. Soils were mintined t 8% of the field pity with deionised H 2 O Erthworms A. liginos erthworms were olleted t the IRD site in Bondy (Seine Sint Denis, Frne). Individuls of similr size nd with well developed litellum were hosen. In ll erthworm tretments, pproximtely 1.7 g of worms (round four nimls), whih orrespond to iomss of 2 g m 2 s ws oserved in some pstures (Zou nd Gonzlez, 1996), were dded to miroosms four weeks prior to the introdution of the plnts (D) in order to mximize erthworm effets. Control miroosms (without erthworms) lso were prepred nd inuted for four weeks efore D Plnt growth A. thlin (L.) Heynh. eotype Columi seeds were germinted in the drk on wet Whtmn pper. When otyledons were fully open (six dys fter germintion), plntlets were trnsferred to miroosms on the sis of one plnt per miroosm. Plnt growth ws rried out under ontrolled onditions (Conviron growth hmer, Cnd): 2 1 C nd 18 1 C dy nd night tempertures, 7% 5% reltive humidity, 4 mmol m 2 s 1 PPFD for 1 h per dy Plnt tretments Aridopsis plntlets were trnsferred to different types of miroosms ontining the rih soil (with or without erthworms) or the poor soil (with or without erthworms). Six replites were set up for eh tretment omintion. For oth soils, dditionl no-plnt ontrol miroosms were set up (with or without erthworms). Three replites were set up for eh ontrol. The distriution of the miroosms in the growth hmer ws rndomized nd hnged fter eh iweekly wtering Plnt smpling nd totl RNA extrtion To smple plnt tissue t similr developmentl stge, ll plnt smples were olleted upon formtion of the florl uds. Totl lef nd root mterils were olleted from three of the six replites, snp-frozen in liquid nitrogen nd stored t 8 C. Lef ris were systemtilly removed from the lef smples. Totl RNA extrtion ws rried out using RNesy Plnt Minikit (Qigen, Frne) on 1 mg nd 5 mg of fresh lef nd root mterils, respetively, following the mnufturer's instrutions. DNAse I (Promeg, Frne) tretment ws pplied to ll RNA extrts. RNA quntifition ws done t 26 nm, using NnodropÒ ND-1 UVeVis spetrophotometer (NnoDrop Tehnologies, Wilmington, USA) RT-PCR nlysis First strnd DNA synthesis ws performed in 2 ml retions on 15 ng of totl RNA using four units of Omnisript reverse
3 246 U. Jn et l. / Soil Biology & Biohemistry 42 (21) 244e252 Tle 1 Nuleotidi sequenes nd melting tempertures of the five primer pirs used in RT-PCR retions. Genes Sequenes of primers Tm HBT (AtHBT-f) 5 GATAGAAGGAAGAATGCTGC3 52 C HBT (AtHBT-r) 5 TACTGCTTTTGAATGGAGAGAG3 ICK1 (AtICK1-f) 5 GGTTATTTATTTGACTCTCTCT C ICK1 (AtICK1-r) 5 ATTCTTCTTTCTCCTCCTCT3 PLD lph (AtPLD-f) 5 CCAAAACAAGGAGGAGATG3 52 C PLD lph (AtPLD-r) 5 CAGGGTTACGAGGACACAAAA 3 RUBISCO (AtpRUB-f) 5 GTTGAAGGAAGTGGAAGAGT 3 5 C RUBISCO (AtpRUB-r) 5 TACACAAAAGCAAAGGGAAA 3 SOD (AtSOD-f) 5 TGTCTACTGGTCCACATTTCAAC3 57 C SOD (AtSOD-r) 5 TTTCCGAGGTCATCAGGGTCT3 S19 (AtS19-f) 5 TCCAGGAAGCAGTTCGTTATTGAT3 6 C S19 (AtS19-r) 5 CTGGTGATGCCAAGAAGAAGTGA3 trnsriptse (Qigen, Frne) nd 1 mm of oligo-dt primers, ording to the mnufturer's instrutions. Trnsript undne of the Aridopsis genes listed in Tle 1 ws nlyzed y semiquntittive RT-PCR using 1 ml of DNA otined from leves nd roots nd the primers shown in Tle 1. 2mL PCR retions were performed in Mster Cyler Grdient thermoyler (Eppendorf AG, Germny), using the Tq PCR Mster mix (Promeg, Frne). For eh primer pir, the optiml numer of yles ws determined during preliminry retions. PCR retions were s follows: 5 min t 94 C followed y 3e4 yles (3 s t 94 C, 3 s t nneling temperture, 3 s t 72 C) nd 1 min t 72 C. PCR produts were nlyzed fter seprtion on ethidium romide stined 1% grose gels. Fluoresene imges of PCR produts were digitized nd quntified, using the Gel-Do Quntity One softwre (BioRd, Frne) DNA loning nd sequening PCR produts were loned in the pgem-tesy vetor plsmid system (Promeg, Frne), following the mnufturer's instrutions. Plsmidi DNA preprtion ws rried out using the Wizrd Plus SV minipreps DNA purifition kit (Promeg, Frne). Sequening ws performed on oth strnds using the AiPrism system (Genosreen, Frne) Mrosopi mesurements For eh tretment, plnt iomss nlysis ws rried out on three of the six replites. Rosette dimeter ws mesured upon forming of the florl ud. At the end of plnt yle (pproximtely two months fter trnsfer of the seedlings to the miroosms), fresh weight nd mximl length of florl stems nd roots were determined. Roots were wshed to remove soil prtiles. For eh plnt, the numer of olts nd mture siliques, the mss of totl seed prodution nd the weight of 1 seeds were determined. Clen vegettive orgns were dried for two dys t 7 C nd weighed. Cron nd nitrogen ontents (C/N rtios) were determined using CHN elementl nlyzer (Thermo Finnign Flsh EA1112) in roots, leves, olts nd seeds, seprtely. Root iomss distriution etween dimeter lsses ws estlished ording to the method of Blouin et l. (27) on dried root systems. Briefly, shredded dry roots were sieved on olumn of sieves with deresing mesh sizes; iomss distriution ording to root dimeter ws ssessed y weighing the iomss reovered in eh sieve (Blouin et l., 27) Soil nlyses Soil nitrte nd mmonium ontents were determined y KCL extrtion nd spetroolorimetry t the INRA Lortoire d'anlyse des Sols in Arrs (Frne). For eh tretment, pproximtively 5 g of soil were tken from three seprte miroosms nd used for nlysis Sttistil nlysis Anlyses were performed using the SAS softwre (SAS, 1989). Output vriles (plnt growth prmeters nd soil nitrogen ontents) were nlyzed using two-wy ANOVA testing for soil nd erthworm effets nd the intertion etween these two ftors. To determine the diretion of signifint effets nd the omintions of tretment nd soil responsile for these effets, multiple omprisons of Lest Squre Mens (SAS, 199) were mde. LSMEANS differenes re summed-up in the Figures, with letters inditing signifint differenes etween tretments. 3. Results ANOVA for ll vegettive nd reprodutive prmeters (exept for the prmeter 1 seed weight) showed tht over 8% of result vriility ws explined y the sttistil model (soil type, erthworm presene, intertions etween these ftors). This suggested tht the experimentl onditions were effiiently ontrolled Erthworm vitlity in the miroosms The erthworms spend three months in the miroosms. At the end of the experiment, erthworms from the different miroosms were refully olleted nd weighed together. In the rih soil, erthworm iomss hd inresed y 2% (n¼6, SD¼3.13) wheres it showed 1% (n ¼ 6, SD ¼ 4.2) derese in the poor soil. No deth ws reorded. Moreover, erthworm tivity ppered to e superior in the poor soil thn in the rih one: in the former, the surfes of the miroosms were ompletely overed with sts, wheres fewer sts were oserved on top of the rih soil Effets of erthworms nd soil qulity on plnt vegettive growth Erthworms nd soil type hd signifint impt on ll plnt vegettive growth prmeters nd severl signifint soil erthworms intertions were oserved (Tle 2). For exmple, erthworms indued three-fold inrese in rosette dimeter in the poor soil wheres they hd no signifint effet on this prmeter, in the rih soil (Fig. 1; Tle 2). As result, rosette dimeters were equivlent in the rih soil nd in the poor soil with the erthworms. Furthermore, the leves of the plnts grown in the poor soil without erthworms were purple nd srwny, wheres in the presene of erthworms, they were right green nd well developed (Fig. 2), s were the leves of the rih soil plnts. Signifint soil erthworm intertion ws lso oserved for root dry iomss. This prmeter ws redued in oth soils in the presene of the erthworms. However, this ws sttistilly signifint in the poor soil only (Fig. 1; Tle 2). Generlly, very low root iomsses were reorded in the rih soil (Fig. 1). Regrdless of soil type, erthworms indued signifint redution (>5%) in the mximl length of root systems (Fig. 1, Tle 2) Effet of erthworms nd soil qulity on plnt reprodutive prmeters In the poor soil, erthworms delyed the forming of florl uds sine infloresenes emerged fter 21 dys of growth in their presene wheres plnts growing without erthworms formed florl uds fter 15 dys. In the rih soil, plnts growing with nd
4 U. Jn et l. / Soil Biology & Biohemistry 42 (21) 244e Tle 2 Erthworms nd soil effets on reprodutive nd vegettive prmeters (P-vlues from two-wy ANOVA). df Rosette dimeter Root system mximl length Root dry iomss R Soil 1 <.1.17 <.1 Erthworm 1 <.1 <.1.14 Soil Erthworm 1 < df Mximum olt length Aove ground iomss Totl seed prodution Numer of silliques Weight of 1 seeds Numer of olts pr plnt R Soil 1 <.1 < Erthworm Soil Erthworm df Shoot/Root Allotion to seeds R Soil Erthworm Soil Erthworm without erthworms formed their florl uds fter 21 dys of growth in the miroosms (Fig. 2). As ws the se for most vegettive growth prmeters, signifint effets of soil erthworm intertion on reprodutive prmeters (numer of siliques, totl seed weight, numer of olts per plnt, mximum olt length, Fig. 3) were found, suggesting tht erthworm impt ws dependent on soil type (Tle 2). In the rih soil, no signifint impt ws reorded (Tle 2). In the poor soil, however, erthworms inresed olt length y 74% (Fig. 3), oveground iomss y 68% (Fig. 3), totl seed weight y 136% (Fig. 3), the numer of siliques per plnt y 21% (Fig. 3d), nd the numer of olts per plnt y 1% (Fig. 3e, Tle 2). The vlues found with erthworms in the poor soil were equivlent to those mesured in the rih soil, with or without erthworms, exept for the verge olt length tht remined 33% lower thn tht of the rih soil plnts (Fig. 3). Neither soil type nor erthworm presene influened the 1 seed weight (Fig. 3f, Tle 2). As desried previously, erthworm-derived enefits on plnt produtivity were limited to the poor soil Chnges in plnt resoure llotion indued y erthworms A onsequene of the presene of erthworms ws drmti hnge in the distriution of iomss within the plnts. In the poor soil, erthworms douled glol plnt iomss llotion to seeds (Tle 2). As result, this prmeter ws equivlent in the poor soil with the erthworms nd in the rih soil with or without erthworms (Fig. 4; Tle 2). There ws no generl effet of erthworms or erthworm soil intertion on shoot/root rtio (Tle 2, Fig. 4). However, when erthworm effets were tested seprtely in the two soils, it ppered tht they signifintly modified plnt morphology in the poor soil, s shown y the signifint inrese in shoot/root rtios (ANOVA, P <.5). In this soil, erthworms lso influened the Rosette dimeter (m) Root iomss (g DW) Root system mximl length (m) Purentge of totl root iomss d Dimeter lsses (µm) Fig. 1. Chnges in () rosette dimeter, () root system iomss, () root system mximl length nd (d) root iomss distriution etween dimeter lsses in Aridopsis thlin plnts grown in rih or poor soil with (lk rs) or without (ontrol; white rs) erthworms Aporretode liginos. Vertil rs indite s.e.m. (n ¼ 3). Signifint differenes etween erthworms vs ontrol s evluted y LSMEANS (P <.5) re indited y different letters.
5 248 U. Jn et l. / Soil Biology & Biohemistry 42 (21) 244e252 Fig. 2. Phenologil plte of Aridopsis thlin ultivted with or without erthworms in the rih or poor soil. Trnsfer: dy 1 (D1) fter trnsfer of seedlings to the miroosms; Florl ud: development of florl uds, Flowering: flower development, Frutifition: silique development. Red rrows indite stress-relted nthoynin uild up in ontrol plnts grown on poor soil (D13, D19). rhiteture of the root systems. The iomss orresponding to fine roots (1e2 mm in dimeter) ws signifintly redued in their presene wheres the iomss lloted to lrger roots (4e5 mm nd 5e63 mm in dimeter) ws inresed (Fig.1d) Effet of erthworms nd soil qulity on plnt C/N rtios Plnt C/N rtios were signifintly ffeted y the erthworms (Tle 3). Overll, they were lower in eril orgns ut the differene ws signifint only in the olt stems s shown y signifint orgn tretment intertion (Fig. 5, Tle 3) Effets of plnts nd erthworms on soil nitrogen sttus Our experimentl design did not llow nlysis of full-model testing simultneously for the effets of erthworms, the presene of plnt nd the soil type, on soil nitrogen sttus (mmonium nd nitrogen ontents). As result, soil-speifi models testing for the effets of erthworms nd plnts (ut not for their intertion) were nlyzed seprtely (Tle 4). In the rih soil, neither the erthworms nor the plnts signifintly impted mmonium or nitrte ontents (Tle 4). In the poor soil on the other hnd, 4.5-fold inrese in nitrte ontent nd.8-fold derese in mmonium ontent were oserved with the erthworms (Fig. 6, Tle 4). Compred with erthworms, plnts hd opposite impt on nitrogen ontents: mmonium onentrtions inresed (þ1%) nd nitrte ontents were lmost depleted ( 9%) (Fig. 6) Erthworms ffet trnsript umultion for trget genes in Aridopsis lef development Regrdless of soil type, erthworms triggered n over-umultion of HBT (NM_14135) trnsripts in the leves (Fig. 7 nd e). Cu/Zn SOD trnsripts were more undnt in the leves of poor soil plnts thn in those growing in the rih soil (Fig. 7 nd ). Lef Cu/Zn SOD trnsript umultion deresed slightly in response to erthworms (Fig. 7 nd ). Contrsting erthworm effets were oserved on lef PLD stedy-stte trnsript levels: strong inrese nd redution in the poor nd rih soil, respetively
6 U. Jn et l. / Soil Biology & Biohemistry 42 (21) 244e Mximum olt length (m) Aove-ground iomss (g DW) Totl seed weight (mg) Numer of siliques d Numer of olts per plnt e Weight of 1, seeds (mg) 2 1 f Fig. 3. Chnges in () mximum olt length, () oveground iomss, () numer of siliques per plnt, (d) totl seed prodution, (e) numer of olts per plnts nd (f) 1 seed weight in Aridopsis thlin plnts grown in rih or poor soil with (lk rs) or without (ontrol; white rs) erthworms Aporretode liginos. Vertil rs indite s.e.m. (n ¼ 3). Signifint differenes etween erthworms vs ontrol s evluted y LSMEANS (P <.5) re indited y different letters. (Fig. 7 nd ). The reverse sitution ws oserved for ICK1 lef trnsripts: they were muh more undnt in the plnts growing in the poor soil nd the erthworm tretment redued their undne wheres erthworms hd slight oosting effet on ICK1 trnsript umultion in the rih soil (Fig. 7 nd d). Generlly, trnsript umultion for the smll nuler-enoded su-unit of Ruiso (RS) remined unffeted y the vrious tretments (Fig. 7) Erthworms ffet trnsript umultion for trget gene in Aridopsis root tissues As ws oserved in the leves, trnsriptionl influene of erthworms ws gene speifi in root tissues. They indued n over-umultion of PLD trnsripts (Figs. 7 nd 5). This ws more pronouned in the poor soil. Erthworms indued strong derese in the umultion of ICK1 trnsripts in the rih soil Biomss llotion to seeds (in %) Rih Soil Poor Soil Shoot / root rtio in the rih soil d 4 2 Shoot / root rtio in the poor soil Fig. 4. Chnges in () llotion to seeds nd () shoot : root rtio in Aridopsis thlin plnts grown in rih or poor soil with (lk rs) or without (ontrol; white rs) erthworms Aporretode liginos. Vertil rs indite s.e.m. (n ¼ 3). Signifint differenes etween erthworms vs ontrol s evluted y LSMEANS (P <.5) re indited y different letters.
7 25 U. Jn et l. / Soil Biology & Biohemistry 42 (21) 244e252 Tle 3 ANOVA for C/N vlues. Intertions etween soil, erthworms nd orgn. Soure DF F P > F Erthworm Orgn <.1 Soil Soil Erthworm Orgn Erthworm Orgn Soil Orgn Erthworm Soil (Fig. 7 nd d). Cu/Zn SOD trnsript levels were not influened y their presene (Fig. 7 nd ). However, SOD trnsript umultion ws higher in the roots of poor soil plnts thn in those growing in the rih soil, s ws oserved in the leves. 4. Disussion 4.1. In the poor soil without erthworms, Aridopsis plnts exhiit minerl defiieny hrteristis Compred to those growing in the rih soil, the plnts ultivted in the poor soil without erthworms showed phenotypi nd developmentl responses typil of minerl -prtiulrly nitrogen (N)-defiieny: erly reprodutive swith, smller shoot to root rtio, s result of higher llotion of ssimiltes to the roots nd severely redued seed yield (Eton, 1935; Sheile et l., 1997; Hiri et l., 24; Hermns et l., 26; Mntelin et l., 26; Remns et l., 26). The lmost omplete depletion of the initil NO 3 ontent in the poor soil y the end of the experiment support the hypothesis of N-strvtion. In omprison, the growth onditions in the rih soil ould e onsidered s ner optimum. This new experimentl system, using oth rih nd poor soil, led to the development of ontrsted plnt phenotypes tht should filitte the identifition of erthworm effets in reltion with soil qulity Erthworms n reverse most effets of poor soil qulity on Aridopsis growth nd development All minerl/nitrogen defiieny symptoms oserved in the plnts growing in the poor soil without erthworm were sent in their ounterprts ultivted in the presene of erthworms. As result, vegettive iomss nd seed prodution with the erthworms were equivlent in the poor nd rih soil plnts. Rosette dimeter ws signifintly inresed nd omprle to tht of the C/N ontent Roots Bolts Leves Seeds Roots Bolts Leves Seeds Fig. 5. Chnges in C/N rtios in the roots, olt stems, leves nd seeds of in Aridopsis thlin plnts grown in rih or poor soil with (lk rs) or without (ontrol; white rs) erthworms Aporretode liginos. Vertil rs indite s.e.m. (n ¼ 3). Signifint differenes due to erthworm effets on eh orgn nd eh soil s evluted y LSMEANS (P <.5) re indited y different letters. Tle 4 ANOVA for nitrte nd mmonium ontents in the rih nd the poor soil (RS nd PS respetively). The totl degrees of freedom is 11 for the rih soil nd 8 for the poor soil. df Nitrte Ammonium Soil RS PS RS PS R Erthworm < <.1 Plnt rih soil plnts. ICK1 nd PLD gene expression nlyses suggested tht this ws medited through enhned ell prolifertion in the lef tissues. The drmti inrese in the nitrte ontent of the poor soil with erthworms ws most likely determining ftor in the omprtively drmti inrese in Aridopsis iomss prodution. In ddition, erthworm-indued high nitrte onentrtions were proly responsile for the signifint redution in the numer of fine roots oserved in the poor soil plnts, s ws previously reported (Zhng nd Forde, 2; Remns et l., 26). Sine deying erthworms were not possile soure of dditionl N (worms survivl rtes were 1%), the mjority of the extr N ws proly formed through minerliztion of soil orgni mtter y gut-ssoited nd st-ssoited miro-orgnisms, in ordne with Brown's hypothesis tht erthworms mostly inrese plnt growth through N minerliztion (Brown et l., 1999). However, reent evidene hve strted n ongoing nd fsinting dete of whether enhned minerliztion lone provides full explntion for the growth stimultion (Brown et l., 24; Sheu, 23; Blouin et l., 26) Some effets of erthworms on Aridopsis re independent of soil qulity An effet of erthworms similrly oserved in oth soils ws the derese in C/N rtios of the oveground tissues (prtiulrly in olt stems). Elevted nitrte ontents hve negtive effet on the mg.kg IS FS SW SP SWP - NO IS FS SW SP SWP + NH 4 Fig. 6. Chnges in () nitrte (mg kg 1 ) nd () mmonium (mg kg 1 ) ontents in the poor soil (IS) t the end of the experiment (FS) indued y the presene of erthworms (Aporretode liginos) (SW), the presene of Aridopsis thlin plnts (SP), nd the omintion of oth (SPW). Vertil rs indite s.e.m. (n ¼ 3).
8 U. Jn et l. / Soil Biology & Biohemistry 42 (21) 244e PLD SOD ICK 1 HBT RS S 19 LEAVES ROOTS RC RE PC PE RC RE PC PE Reltive expression of HBT gene (.u.) 2 1 R R P P Leves Reltive expression of SOD gene (.u.) R R P P R R P P Leves Roots Reltive expression of PLD gene (.u.) d R R P P R R P P Leves Roots Reltive expression of ICK1 gene (.u.) e R R P P R R P P Leves Roots Fig. 7. RT-PCR nlysis of ( nd ) HBT, ( nd ) Cu/Zn SOD, ( nd d) PLD nd ( nd e) ICK1 gene expression in the leves nd roots of Aridopsis thlin plnts grown in rih (R) or poor (S) soil with (lk rs) or without (ontrol; white rs) erthworms Aporretode liginos. The S19 gene ws used s n mplifition ontrol. Reltive gene expression (ritrry units,.u.) ws determined using the Quntity One progrmme (Bio-Rd). trnsport of shoot-derived uxin to roots nd, s onsequene, lter uxin metolism in shoot tissues (C et l., 2; Wlh- Liu et l., 26). In the present experiment, lef uxin metolism seemed ffeted, s shown y the over-umultion of HBT trnsripts in the leves of Aridopsis plnts exposed to erthworms. At the sme time, the hnge in plnt nitrogen sttus llevited the oxidtive stress in the leves, s indited y the generl redution in lef trnsript umultion for Cu/Zn SOD. In the poor soil, the derese in C/N rtio ould esily e sried to the stimultion y erthworms of orgni mtter minerliztion e s mentioned efore e nd enhned nitrifition proesses (Rizhiy et l., 27). In the rih soil, on the other hnd, the nitrte ontent ws not signifintly ffeted. To understnd how pprently N-replete plnts, suh s the rih soil plnts, sored dditionl N in the presene of erthworms, one should refer to the work y Quggiotti et l. (24). These uthors oserved derese in lef C/N resulting from enhned nitrte influx in N-fed mize plntlets exposed to purified extrts of erthworm sts. They onluded tht this phenomenon ws triggered y the uxin-like ompounds (with uxin-like tivity) found in the erthworm sts (Tomti et l., 1988). These results nd ours show tht, in the presene of erthworms, ontrol over minerl/nitrogen nutrition is not neessrily dependnt on the plnt minerl sttus, s is the se with induile uptke systems tht respond to minerl defiieny (Chrispeels et l., 1999). Other generl effets of erthworms were redution in root mximum length nd in glol root iomss, leding to higher shoot/root rtios. In the onfined spe of the miroosms, repeted root rsion y erthworms leding to wounding stress ould ontriute to the limiting of root development. The high levels of PLD trnsripts s ompred to no-worm ontrols suggested tht suh stress ourred sine this gene is responsive to wounding in Aridopsis (Wng, 22). However, the lk of root expnsion ould e result of the erthworm-indued enhned uxin supply t the root level, sine it is knowledged tht root tissues re sink orgns for uxin nd rpidly stop elongting when exposed to inresing onentrtions of the hormone (Chdwik nd Burg, 1966).
9 252 U. Jn et l. / Soil Biology & Biohemistry 42 (21) 244e Conlusion This new experimentl set up onfirms tht orgni mtter minerliztion nd relese of phytohormone-like ompounds re omplementry mehnisms stimulted y erthworms. The ft tht plnts re le to integrte oth proesses t the moleulr level points t the enormous potentil of erthworms in djusting plnt phenotypes in response to environmentl stresses. In ddition, this originl model plnt system opens fsinting new possiilities for follow-up investigtion in the re of plnt/erthworm intertion. Its smll size onstitutes gret sset for the quik nd esy sreening of ndidte miroes with plnt growth enhning pilities. The unique diversity in Aridopsis mutnts (in nitrte uptke nd hormonl signling, for exmple) offers keytools for the identifition of tive ingredient(s) responsile for moleulr nd phenotypi djustments. To onlude, this experimentl set up ould e viewed s n essentil model system to investigte plnt/mrofun nd plnt/mirofun intertions in prtiulr nd soil eology in generl. Aknowledgements The uthors wish to knowledge the Agene Ntionle de l Reherhe for reserh funding (JC5_52229). Referenes Brois, I., Lvelle, P., Brossrd, M., Tondoh, J., Mrtinez, M.A., Rossi, J.P., Senpti, B.K., Angeles, A., Frgoso, C., Jimenez, J.J., Deëns, T., Lttud, C., Knyonyo, J., Blnhrt, E., Chpuis, L., Brown, G., Moreno, A., Eology of erthworm speies with lrge environmentl tolerne nd/or extended distriutions. In: Lvelle, P., Brussrd, L., Hendrix, P. (Eds.), Erthworm Mngement in Tropil Agroeosystems. CABI Pulishing, Wllingford, UK, pp. 57e86. Bemis, S.M., Torii, K.U., 27. Autonomy of ell prolifertion nd developmentl progrms during Aridopsis oveground morphogenesis. Developmentl Biology 34, 367e381. Blnhrt, E., Alreht, A., Alegre, J., Duoisset, A., Pshnsi, B., Lvelle, P., Brussrd, L., Effets of erthworms on soil struture nd physil properties. In: Lvelle, P., Brussrd, L., Hendrix, P. (Eds.), Erthworm Mngement in Tropil. CAB Interntionl, Wllingford, UK, pp. 139e162. Blilou, I., Frugier, F., Folmer, S., Serrlo, O., Willemsen, V., Wolkenfelt, H., Eloy, N.B., Ferreir, P.C., Weiseek, P., Sheres, B., 22. The Aridopsis HOBBIT gene enodes CDC27 homolog tht links the plnt ell yle to progression of ell differentition. Genes Development 16, 2566e2575. Blouin, M., Brot, S., Roumet, C., 27. A quik method to determine root iomss distriution in dimeter lsses. Plnt nd Soil 29, 371e381. Blouin, M., Brot, S., Lvelle, P., 26. Erthworms (Millsoni noml, Megsoleide) do not inrese rie growthy through enhned nitrogen minerliztion. Soil Biology nd Biohemistry 38, 263e268. Blouin, M., Zuily-Fodil, Y., Phm-Thi, A.T., Lffry, D., Reverst, G., Pndo, A., Tondoh, J., Lvelle, P., 25. Belowground orgnism tivities ffet plnt oveground phenotype, induing plnt tolerne to prsites. Eology Letters 8, 22e28. Brown, G., Edwrds, C.A., Brussrd, L., 24. How erthworms ffet plnt growth: urrowing into the mehnisms. In: Edwrds, C.A. (Ed.), Erthworm Eology. CRC Press, Bo Rton, USA, pp. 13e49. Brown, G., Brois, I., Lvelle, P., 2. Regultion of soil orgni mtter dynmis nd miroil tivity in the drilosphere nd the role of intertions with other edphi funtionl domins. Europen Journl of Soil Biology 26, 177e198. Brown, G., Pshnsi, B., Villenve, C., Ptron, J.C., Senpti, B.K., Giri, S., Brois, I., Lvelle, P., Blnhrt, E., Blkemore, R.J., Spin, A.V., Boyer, J., Effets of erthworms on plnt prodution in the tropis. In: Lvelle, P., Brussrd, L., Hendrix, P. (Eds.), Erthworm Mngement in Tropil Agroeosystems, Wllingford, pp. 87e137. C, J.M., Centeno, M.L., Fernndez, B., Gresshoff, P.M., Ligero, F., 2. Inoultion nd nitrte lter phytohormone levels in soyen roots: differenes etween supernodulting mutnt nd the wild type. Plnt 211, 98e14. Cnells, L.P., Olivres, F.L., Okorokov-Fnh, A.L., Fnh, A.R., 22. Humi ids isolted from erthworm ompost enhne root elongtion, lterl root emergene, nd plsm memrne H þ -ATPse tivity in mize roots. Plnt Physiology 13, 1951e1957. Chdwik, A.V., Burg, S.P., An explntion of the inhiition of root growth used y Indole-3-Aeti Aid. Plnt Physiology 42, 415e42. Chrispeels, M., Crwford, N., Shroeder, J., Proteins for trnsport of wter nd minerl nutrients ross the memrnes of plnt ells. The Plnt Cell 11, 661e675. Clpperton, M.J., Lee, N.O., Binet, F., Conner, R.L., 21. Erthworms indiretly redue the effets of tke-ll (Geumnnomyes grminis vr. tritii) on soft white spring whet (Tritium estivum v Fielder). Soil Biology nd Biohemistry 33, 1531e1538. Eton, S.V., The nture nd properties of soils. Botnil Gzette 97, 68e1. Frnis, D., 27. The plnt ell yle -15 yers on. New Phytologist 174, 261e278. Hermns, C., Hmmond, J.P., White, P.J., Verruggen, N., 26. How do plnts respond to nutrient shortge y iomss llotion? Trends in Plnt Siene 11, 61e617. Hiri, M.Y., Yno, M., Goodenowe, D.B., Kny, S., Kimur, T., Awzuhr, M., Arit, M., Fujiwr, T., Sito, K., 24. Integrtion of trnsriptomis nd metolomis for understnding of glol responses to nutritionl stresses in Aridopsis thlin. Proeedings of the Ntionl Ademy of Siene of the United Sttes of Ameri 11, 125e121. Kmink, H., Morit, S., Tokumoto, M., Yokoym, H., Msumur, T., Tnk, K., Moleulr loning nd hrteriztion of DNA for n iron-superoxide dismutse in rie (Oryz stiv L.). Biosienes Biotehnology Biohemistry 63, 32e38. Krishnmoorthy, R.V., Vjrnhih, S.N., Biologil tivity of erthworm sts: n ssessment of plnt growth promotor levels in sts. Proeedings of the Indin Ademy of Sienes (Animl Siene) 95, 341e351. Lfont, A., Risede, J.M., Lornyer-Meriris, G., Clermont-Duphin, C., Dorel, M., Rhino, B., Lvelle, P., 27. Effets of the erthworm Pontosolex orethrurus on nn plnts infeted or not with the plnt-prsiti nemtode Rdopholus similis. Pedoiologi 51, 311e318. Lee, K.E., Erthworms, Their Eology nd Reltionships with Soils nd Lnd Use. Ademi Press, Sydney, Austrli. Mntelin, S., Desrosses, G., Lrher, M., Trnrger, T.J., Cleyet-Mrel, J.C., Tourine, B., 26. Nitrte-dependent ontrol of root rhiteture nd N nutrition re ltered y plnt growth promoting Phylloterium sp. Plnt 223, 591e63. Musolo, A., Cutrupi, S., Nrdi, S., IAA detetion in humi sustnes. Soil Biology nd Biohemistry 3, 1199e121. Musolo, A., Bovlo, F., Nrdi, S., Erthworm humi mtter produes uxinlike effets on Duus rot ell growth nd nitrte metolism. Soil Biology nd Biohemistry 31, 133e1311. Nielsen, T.H., Krpp, A., Röper-Shwrz, U., Stitt, M., The sugr medited regultion of genes enoding the smll suunit of Ruiso nd the regultory suunit of ADP gluose pyrophosphorylse is modified y phosphte nd nitrogen. Plnt, Cell nd Environment 21, 443e454. Postm-Bluw, M.B., Bloem, J., Fer, J.H., vn Groenigen, J.W., de Goede, R.G.M., Brussrd, L., 26. Erthworm speies omposition ffets the soil teril ommunity nd net nitrogen minerliztion. Pedoiologi 5, 243e256. Quggiotti, S., Ruperti, B., Pizzeghello, D., Frnioso, O., Tugnoli, V., Nrdi, S., 24. Effet of low moleulr size humi sustnes on nitrte uptke nd expression of genes involved in nitrte trnsport in mize (Ze mys L). Journl of Experimentl Botny 55, 1e11. Remns, T., Nry, P., Pervent, M., Girin, T., Tillrd, P., Lepetit, M., Gojon, A., 26. A entrl role for the nitrte trnsporter NRT2.1 in the integrted morphologil nd physiologil responses of the root system to nitrogen limittion in Aridopsis. Plnt Physiology 14, 99e921. Rizhiy, E., Bertor, C., vn Vliet, P.C.J., Kuikmn, P.J., Fer, J.H., vn Groeningen, J.W., 27. Erthworm tivity s determinnt for NO 2 emission from rop residue. Soil Biology nd Biohemistry 39, 258e269. Skmoto, A., Okumur, T., Kmink, H., Sumi, K., Tnk, K., Struture nd differentil response to sisi id of two promoters for the ytosoli opper/ zin- superoxide dismutse genes, SodCl nd SodC2, in rie protoplsts. FEBS Letters 358, 62e66. SAS, SAS/STAT User's Guide, Version 6, fourth ed. SAS Institute, Cry. SAS, 199. GLM proedure. In: SAS/GRAPH Softwre, Version 6, vol. 2. SAS Institute In., Cry, USA. Sheile, W.R., Gonzles-Fontes, A., Luerer, M., Müller-Röer, B., Cohe, M., Stitt, M., Nitrte ts s signl to indue orgni id metolism nd repress strh metolism in too. Plnt Cell 9, 783e798. Sheu, S., 23. Effets of erthworms on plnt growth: ptterns nd perspetives: the 7th interntionl symposium on erthworm eology Crdiff Wles 22. Pedoiologi 47, 846e856. Senpti, B.K., Bioti intertions etween soil nemtodes nd erthworms. Soil Biology nd Biohemistry 24, 1441e1444. Tomti, U., Grppelli, A., Glli, E., The hormone-like effet of erthworm sts on plnt growth. Biology nd Fertility of Soils 5, 288e294. Wlh-Liu, P., Ivnov, I.I., Filleur, S., Gn, Y., Remns, T., Forde, B.G., 26. Nitrogen regultion of root rnhing. Annls of Botny 97, 875e881. Wng, H., Qi, Q., Shorr, P., Cutler, A.J., Crosy, W.L., Fowke, L.C., ICK1, ylindependent protein kinse inhiitor from Aridopsis thlin interts with oth Cd2 nd CyD3, nd its expression is indued y sisi id. Plnt Journl 15, 51e51. Wng, X., 22. Phospholipse D in hormonl nd stress signling. Current Opinion in Plnt Biology 5, 48e414. Xu, L., Zheng, S., Zheng, L., Wng, X., Promoter nlysis nd expression of phospholipse D gene from stor en. Plnt Physiology 115, 387e395. Yetes, G.W., Soil nemtode popultions depressed in the presene of erthworms. Pedoiologi 22, 191e195. Zhng, H., Forde, B.G., 2. Regultion of Aridopsis root development y nitrte vilility. Journl of Experimentl Botny 51, 51e59. Zou, X., Gonzlez, G., Chnges in erthworm density nd ommunity struture during seondry suession in ndoned tropil pstures. Soil Biology nd Biohemistry 29, 627e629.
EFFECT OF DIFFERENT CONCENTRATIONS OF IBA AND CUT TYPE ON ROOT INDUCTION AND MORPHOLOGICAL PROPERTIES OF CLOVE (DIANTHUS CARYOPHYLLUS)
Indin Journl of Fundmentl nd Applied Life Sienes ISSN: 2231 6345 (Online) An Open Aess, Online Interntionl Journl Aville t www.iteh.org/sp.ed/jls/2014/04/jls.htm 2014 Vol. 4 (S4), pp. 2986-2992/Fteme et
More informationBiochar as a Substitute for Vermiculite in Potting Mix for Hybrid Poplar
Bioenerg. Res. (1) 7:1 131 DOI 1.17/s1155-13-9355-y Biohr s Sustitute for Vermiulite in Potting Mix for Hyrid Poplr Willim L. Hedlee & Ctherine E. Brewer & Rihrd B. Hll Pulished online: 16 July 13 # Springer
More informationThe wheat response to drought and salinity stresses
Cumhuriyet Üniversitesi Fen Fkültesi Fen Bilimleri Dergisi (CFD), Cilt:36, No: 3 Özel Syı (215) ISSN: 13-1949 Cumhuriyet University Fulty of Siene Siene Journl (CSJ), Vol. 36, No: 3 Speil Issue (215) ISSN:
More informationImpact analysis of different chemical pre-treatments on colour of apple discs during drying process
Crot. J. Food Si. Tehnol. (29) 1 (1) 31-35 Impt nlysis of different hemil pre-tretments on olour of pple diss during drying proess D. Mgdić *, Jsmin Lukin, Stel Jokić, F. Ččić-Kenjerić, M. Bilić, D. Velić
More informationDifferential responses of root system and gas exchange in contrasting tomato genotypes under phosphorus starvation
AJCS ():- () ISSN:3-77 Differentil responses of root system nd gs exhnge in ontrsting tomto genotypes under phosphorus strvtion Dougls José Mrques*, Ernni Clrete d Silv, Mozrt Mrtins Ferreir 3, Crlos Muríio
More informationCarbon and nitrogen pools in different aggregates of a Chinese Mollisol as influenced by long-term fertilization
DOI 10.1007/s11368-009-0123-8 SOILS, SEC 2 GLOBAL CHANGE, ENVIRON RISK ASSESS, SUSTAINABLE LAND USE RESEARCH ARTICLE Crbon nd nitrogen pools in different ggregtes of Chinese Mollisol s influened by long-term
More informationThe New Era of Rainwater Harvesting
The New Er of Rinwter Hrvesting EVERY DROP COUNTS With rising wter usge osts, growing pressure on infrstruture nd environmentl onerns, it is eoming inresingly importnt to pture nd utilise the free rinwter
More informationCabbage Transplant Production Using Organic Media, 2008
Cge Trnsplnt Production Using Orgnic Medi, 2008 Anu Rngrjn, Cornell University, Deprtment of Horticulture, r47@cornell.edu Betsy Leonrd, Cornell University, Deprtment of Horticulture, i1@cornell.edu Allison
More informationPP N NOMINAL DEPTH FILTER ELEMENTS FEATURES & BENEFITS. Process Filtration
PP N NOMINAL DEPTH FILTER ELEMENTS Proess Filtrtion Donldson LifeTe PP N filters re nominl rted depth type filters onstruted of 100% polypropylene. They ontin n symmetril polypropylene mirofier filter
More informationResearch Article Identification of Constraining Experimental-Design Factors in Mycorrhizal Pot-Growth Studies
Journl of Botny Volume, Artile ID 7113, pges doi:.1155//7113 Reserh Artile Identifition of Constrining Experimentl-Design Ftors in Myorrhizl Pot-Growth Studies Ptrik Audet nd Christine Chrest Deprtment
More informationUse of LS 213 During Rooting of Vegetative Ornamental Cuttings: Experiment 1
NC STATE UNIVERSITY Floriculture Reserch Deprtment of Horticulturl Science Horticulturl Reserch Series No. 15 My 1 Use of LS 1 During Rooting of Vegettive Ornmentl Cuttings: Experiment 1 Brin E. Whipker,
More informationPreliminary Report on the Mineral Composition of Papaya Soil and Plant Tissue in Puna, Hawaii Under Different Land Use Practices
Preliminry Report on the Minerl Composition of Ppy Soil nd Plnt Tissue in Pun, Hwii Under Different Lnd Use Prties CHANTAL VOS 1* AND ALYSSA CHO 2 1 University of Hwii t Hilo, College of Agriulture, Forestry
More informationInorganic Phosphorus Fractions Dynamics Following Phosphorus Application on Maize in Acid Soils
Amerin-Eursin J. Agri. & Environ. Si., 8 (6): 793-8, ISSN 88-6769 IDOSI Pulitions, Inorgni Phosphorus Frtions Dynmis Following Phosphorus Applition on Mize in Aid Soils 3 Thienkou, Wolfgng, Zeh nd Nterngy
More informationMETHYL BROMIDE ALTERNATIVES, FOCUS ON ROOTSTOCKS
METHYL BROMIDE ALTERNATIVES, FOCUS ON ROOTSTOCKS Mihel MKenry ABSTRACT Tolerne to the rejetion omponent of the replnt prolem is otined y swithing rootstoks. We hve found this true with Vitis, Prunus nd
More informationDISEASE CONTROL WITH QUALITY COMPOST IN POT AND FIELD TRIALS.
I Interntionl Conferene Septemer 15th 17th 24, León - Spin DISEASE CONTROL WITH QUALITY COMPOST IN POT AND FIELD TRIALS. Jques G. FUCHS, Mohmed LARBI FiBL, Reserh Institute of Orgni Agriulture, CH-Frik
More informationBehaviour, social interactions and lesion scores of group-housed sows in relation to floor space allowance
. Applied Animl Behviour Siene 59 1998 307 316 Behviour, soil intertions nd lesion sores of group-housed sows in reltion to floor spe llowne R.C. Weng,,), S.A. Edwrds, P.R. English SAC, Cristone Estte,
More informationCover Crop and Mulching Effects on Yield and Fruit Quality in Unsprayed Organic Apple Production
Europ.J.Hort.Si., 74 (6). S. 247 253, 2009, ISSN 1611-4426. Verlg Eugen Ulmer KG, Stuttgrt Cover Crop nd Mulhing Effets on Yield nd Fruit Qulity in Upryed Orgni Apple Prodution B.F. Kühn nd H. Lindhrd
More informationSalisylic Acid Foliar and Soil Application Effect on Chickpea Resistance to Chilling Stress
11 Interntionl Conferene on Biology, Environment nd Chemistry IPCBEE vol. (11) (11)IACSIT Press, Singpoore Slisyli Aid Folir nd Soil Applition Effet on Chikpe Resistne to Chilling Stress Simk Immi 1, Soleimn
More informationJournal of Integrative Agriculture 2016, 15(2): Available online at ScienceDirect
Journl of Integrtive Agriulture 216, 15(2): 295 38 Aville online t www.sienediret.om SieneDiret RESEARCH ARTICLE Effets of hilling tolerne indued y spermidine pretretment on ntioxidtive tivity, endogenous
More informationThis is a repository copy of Importance of different components of green roof substrate on plant growth and physiological performance.
This is repository opy of Importne of different omponents of green roof sustrte on plnt growth nd physiologil performne. White Rose Reserh Online URL for this pper: http://eprints.whiterose..uk/8075/ Version:
More informationJournal of Integrative Agriculture 2016, 15(0): Available online at ScienceDirect
Journl of Integrtive Agriulture 016, 15(0): 60345-7 Aville online t www.sienediret.om SieneDiret RESEARCH ARTICLE Sliyli id llevites posthrvest hilling injury of sponge gourd (Luff Cylindri) HAN Cong 1,,
More informationEffect of Air Pollution on Root Growth and Productivity of Anagallis Arvensis
2011 Interntionl onferene on iology, Environment nd hemistry IPEE vol.24 (2011) (2011)ISIT Press, Singpoore Effet of ir Pollution on Root Growth nd Produtivity of ngllis rvensis Squi Mohmmd eprtment of
More informationEffect of organic fertilizers on quality and quantity of tobacco transplanting in various nursery media
Life Siene Journl 2012;9(4) Effet of orgni fertilizers on qulity nd quntity of too trplnting in vrious nursery medi Li Mord-eigi 1, Rez Amirni 2, Mehdi Tjkhsh 3 nd RminTgvi 4 1 Agriulture grdute student
More informationEffects of excess boron on growth, gas exchange, and boron status of four orange scion rootstock combinations
J. Plnt Nutr. Soil Si. 21, 173, 469 476 DOI: 1.12/jpln.28273 469 Effets of exess oron on growth, gs exhnge, nd oron sttus of four ornge sion rootstok omintions Ou Sheng 1,2, Gofeng Zhou 1, Qingjing Wei
More informationPropagation of citrus rootstocks in greenhouses by seed, stem cuttings and tissue culture to accelerate budded tree production for out planting.
Propgtion of citrus rootstocks in greenhouses by seed, stem cuttings nd tissue culture to ccelerte budded tree production for out plnting. Richrd C. Beeson Jr. Assoc. Professor Mid-Florid Reserch nd Eduction
More informationConcentration and vertical distribution of total soil phosphorus in relation to time of abandonment of arable fields
Nutr Cyl Agroeosyst (2007) 79:73 79 DOI 10.1007/s10705-007-9097-3 ORIGINAL PAPER Conentrtion nd vertil distriution of totl soil phosphorus in reltion to time of ndonment of rle fields A. vn der Wl Æ W.
More informationResidual effects of topsoil replacement depths and onetime application of organic amendments in natural gas wellsite reclamation
Residul effets of topsoil replement depths nd onetime pplition of orgni mendments in nturl gs wellsite relmtion Frnis J. Lrney, Andrew F. Olson, nd Pul R. DeMere Agriulture nd Agri-Food Cnd, Reserh Centre,
More informationEffects of Aluminum, Iron and/or Low ph on Rice Seedlings Grown in Solution Culture
INTERNATIONAL JOURNAL OF AGRICULTURE & BIOLOGY ISSN Print: 1560 8530; ISSN Online: 1814 9596 14 784/2015/17 4 702 710 DOI: 10.17957/IJAB/14.0019 http://www.fspulishers.org Full Length Artile Effets of
More informationShoot Growth Characteristics Following Mechanical Hedging and High Limb Pruning in Tulare Walnuts on Two Rootstocks at Two Spacings
Shoot Growth Chrcteristics Following Mechnicl Hedging nd High Lim Pruning in Tulre Wlnuts on Two Rootstocks t Two Spcings B.D. Lmpinen, S.G. Metclf, V. Gmle, K. Moore nd W. Reil University of Cliforni
More informationJournal of Agriculture and Life Sciences ISSN (Print), (Online) Vol. 4, No. 1, June 2017
Journl of Agriculture nd Life Sciences ISSN 2375-4214 (Print), 2375-4222 (Online) Vol. 4, No. 1, June 217 Effects of Chemicl Form nd Nitrogen Concentrtion of Fertilizer nd Wter Culture Medium ph on Growth
More informationCapacitor Voltage Balancing Control for a Modular Matrix Converter
pitor Voltge lning ontrol for Modulr Mtrix onverter S. ngkititrkul nd R. W. Erikson olordo Power Eletronis enter University of olordo oulder, O 80309-0425, US ngkitis@olordo.edu strt This pper desries
More informationTAGETES ERECTUS L. A POTENTIAL RESOLUTION FOR MANAGEMENT OF PARTHENIUM HYSTEROPHORUS L.
Pk. J. Bot., 43(2): 885-894, 11. TAGETES ERECTUS L. A POTENTIAL RESOLUTION FOR MANAGEMENT OF PARTHENIUM HYSTEROPHORUS L. SHAZIA SHAFIQUE *, RUKHSANA BAJWA AND SOBIYA SHAFIQUE Institute of Plnt Pthology,
More informationSynthesis and investigation of optical properties of ZnS nanostructures
Bull. Mter. Si., Vol. 34, No. 2, April 2011, pp. 287 292. Indin Ademy of Sienes. Synthesis nd investigtion of optil properties of ZnS nnostrutures NESLIHAN ÜZAR nd M ÇETIN ARIKAN Physis Deprtment, Siene
More informationCRANFIELD UNIVERSITY GIORGOS DIMITRIOU PANAGIOTAKIS. RESPONSE OF FOUR GRAFTED EGGPLANTS TO NaCl SALINITY
1 CRANFIELD UNIVERSITY GIORGOS DIMITRIOU PANAGIOTAKIS RESPONSE OF FOUR GRAFTED EGGPLANTS TO NCl SALINITY CRANFIELD HEALTH PhD THESIS 2013 Pngiotkis D. Giorgos Crnfield University PhD Thesis, 2013 2 CRANFIELD
More informationThe Use of Naphthaleneacetic Acid (NAA) to Control Vegetative Vigor in Avocado Trees
Cliforni Avocdo Society 27 Yerook 9: 131-148 Mry Lu Arpi Deprtment of Botny nd Plnt Sciences University of Cliforni, Riverside Muricio Tpi ACW Frm Fllrook, Cliforni Reuen Hofshi vocdosource.com Fllrook,
More informationVermicompost Effects on the Growth and Flowering of Petunia hybrida Dream Neon Rose
Amerin-Eursin J. Agri. & Environ. Si., 3 (3): 56-512, 28 ISSN 1818-6769 IDOSI Publitions, 28 Vermiompost Effets on the Growth nd Flowering of Petuni hybrid Drem Neon Rose 1 E. Chmni, 2 D.C. Joye nd 3 A.
More informationFundamental and Applied Agriculture Vol. 4(1), pp : 2019 doi: /faa.13554
Fundmentl nd Applied Agriulture Vol. 4(1), pp. 713 722: 219 doi: 1.5455/f.13554 Crop Siene ORIGINAL ARTICLE Hydrogen peroxide priming llevites hilling stress in rie (Oryz stiv L.) by enhning oxidnt svenging
More informationSpecial Research Report #532 Production Technology Using Soil Moisture Sensors for Poinsettia Height Control
Specil Reserch Report #532 Production Technology Using Soil Moisture Sensors for Poinsetti Height Control Alem Peter 1, Pul Thoms 1, Mrc vn Iersel 1, nd Stephnie Burnett 2 1 Deprtment of Horticulture,
More informationTiming of snowmelt. SnoEco
SnoEco: High Arctic ecosystem responses to chnges in snow cover Elisbeth J. Cooper - study t the plot nd lndscpe scle UiT- The Arctic University of Norwy Tromsø, Norwy Timing of snowmelt..is very importnt
More informationEffects of Water and Nitrogen Utilized by Means of Dripping on Growth of Root and Canopy and Matter Distribution in Spring Wheat
Advnce Journl of Food Science nd Technology 5(4): 474-481, 2013 ISSN: 2042-4868; e-issn: 2042-4876 Mxwell Scientific Orgniztion, 2013 Sumitted: Decemer 26, 2012 Accepted: Ferury 08, 2013 Pulished: April
More informationENHANCING OFF-SEASON PRODUCTION THROUGH GRAFTED TOMATO TECHNOLOGY
Philippine Journl of Crop Siene 22, 27(2): 3-9 Copyright 24, Crop Siene Soiety of the Philippines Relesed Deember 24 ENHANCING OFF-SEASON PRODUCTION THROUGH GRAFTED TOMATO TECHNOLOGY CLARITA P AGANON,
More informationEffect of Varying Concentration of Nickel and Cobalt on the Plant Growth and Yield of Chickpea
Austrlin Journl of Bsi nd Applied Sienes, 4(6): 1036-1046, 2010 ISSN 1991-8178 Effet of Vrying Conentrtion of Nikel nd Coblt on the Plnt Growth nd Yield of Chikpe Mujeebur Rhmn Khn nd Mohd. Mhmud Khn Deprtment
More informationControl of Rhizoctonia and Pythium on soybeans (Glycine max) using Trichoderma and silicon
Control of Rhizotoni n Pythium on soyens (Glyine mx) using Trihoerm n silion R. Bosse, P.M. Clwell *, S. Yoo n M.D. Ling Shool of Agriulturl Sienes n Agriusiness, Disipline of Plnt Pthology, University
More informationInstaller and user reference guide
Instller nd user referene guide - + BRC1H51W BRC1H51K BRC1H51S English Tle of ontents Tle of ontents 1 Generl sfety preutions 2 1.1 For the user... 2 1.2 For the instller... 3 2 Aout this doument 3 For
More informationFood Technology & Nutrition / Summer 2011 / Vol. 8 / No. 3. jftn.srbiau.ac.ir. b c.
c 1389/3/12 : * c 1388/10/28 : :.. :. 60.. jftn.sriu.c.ir :.. :.. : 46 emil: m-honrvr@hotmil.com * 47 3 / /1390 /. ph.(kle et l., 1992) ph. (Bowmn & Reinecke, 1991) Rienecke &Vilijoen, ).(1990.(www.memers.tripod.com)
More informationWorkholding Systems. VarioLine /2015
Workholding Systems VrioLine 12/2015 2.3170 VrioLine For vertil use Pressure guge s n option for ext lmping fore disply nd monitoring. A unique HILMA dvntge. or horizontl use Your enefits t glne: Adpttion
More informationInteraction with ethylene: changing views on the role of abscisic acid in root and shoot growth responses to water stress
Blckwell Science, LtdOxford, UK PCEPlnt, Cell nd Environment16-825Blckwell Science Ltd 21 25 798 ABA, ethylene nd root nd shoot growth R. E. Shrp Review ArticleBEES SGML Plnt, Cell nd Environment (22)
More informationPerformance evaluation of displacement ventilation system combined with a novel evaporative cooled ceiling for a typical office in the city of Beirut
Avilble online t www.sciencedirect.com ScienceDirect Energy Procedi 75 (2015 ) 1728 1733 The 7 th Interntionl Conference on Applied Energy ICAE2015 Performnce evlution of displcement ventiltion system
More informationThe growth of camellia in growth media containing composted organic wastes of peanut
Aville online t www.pelgireserchlirry.com Pelgi Reserch Lirry Europen Journl of Experimentl Biology, 2014, 4(1):608-612 ISSN: 2248 9215 CODEN (USA): EJEBAU The growth of cmelli in growth medi contining
More informationInvestigation the Effects of Cadmium Chloride and Copper Sulfate on Germination and Seedling Growth of Agropyron elongatum
www.senet.org/ms Modern Applied Siene Vol. 5, No. 5; Otoer 11 Investigtion the Effets of Cdmium Chloride nd Copper Sulfte on Germintion nd Seedling Growth of Agropyron elongtum Mortez Seri(Corresponding
More informationExpro is a key provider of reliable downhole video technology to the oil and gas industry, providing our clients with clear answers in the toughest
DOWNHOLE VIDEO (DHV) exprogroup.om Expro is key provider of relible downhole video tehnology to the oil nd gs industry, providing our lients with ler nswers in the toughest environments. With the pbility
More informationTropical Grasslands (2003) Volume 37,
Tropil Grsslnds (23) Volume 37, 11 19 11 Nitrogen fixtion nd growth of owpe (Vign unguiult) nd ym en (Phyrhizus erosus) in sodi soil s ffeted y gypsum nd sulphur inoulted with Thioillus nd rhizoil inoultion
More informationAbstract. Introduction
In vitro propgtion of Dmsk Roses 85 In vitro propgtion of three Dmsk Roses essions Bhreh Allhverdi Mmghni, Mhlgh Ghornli 2*, Mohmmd Hssn Assreh,nd As Ghmri Zre Reserh Institutes of Forests nd Rngelnds,
More informationThe Effects of Different Sucrose, Agar and ph Levels on In Vitro Shoot Production of Almond (Amygdalus communis L.)
Tr. J. of otny (199) 363-373 TÜİTK Reserh rtile The Effets of Different Surose, gr nd ph Levels on In Vitro Shoot Prodution of lmond (mygdlus ommunis L.) Songül GÜREL Sugr Institute, Plnt reeding Deprtment,
More informationThe effect of phosphate bio-fertilizer (Barvar-2) on the growth of marigold
Journl Home pge : www.je.o.in «E-mil : editor@je.o.in JEB Journl of Environmentl Biology ISSN: 025-870 CODEN: JEBIDP Pulition Info Pper reeived: 21 Deemer 2012 Revised reeived: 21 My 201 Re-Revised reeived:
More informationActa Sci. Pol. Hortorum Cultus, 17(5) 2018,
www.ct.medi.pl ORIGINAL PAPER Act Sci. Pol. Hortorum Cultus, 17(5) 2018, 191 198 1644-0692 e-issn 2545-1405 DOI: 10.24326/sphc.2018.5.17 Accepted: 4.04.2018 ROOT GROWTH CHARACTERISTICS OF KHATOUNI MELON
More informationFactors affecting in vitro plant regeneration from cotyledonary node explant of Senna sophera (L.) Roxb. A highly medicinal legume
Vol. 13(3), pp. 413-422, 15 Jnury, 214 DOI: 1.5897/AJB213.13126 ISSN 1684-5315 214 Ademi Journls http://www.demijournls.org/ajb Afrin Journl of Biotehnology Full Length Reserh Pper Ftors ffeting in vitro
More informationEvaluating Kaolin Clay as an Amendment to Container Substrates
Evluting Kolin Cly s n Amendment to Continer Sustrtes Jmes T. Midcp nd Theodore E. Bilderck Deprtment of Horticulture - Athens & Rleigh The University of Georgi & North Crolin Stte University Nture of
More informationOperation manual. Daikin Altherma Low temperature split EABH16DA6V EABH16DA9W EABX16DA6V EABX16DA9W
EABH16DA6V EABH16DA9W EABX16DA6V EABX16DA9W EAVH16S18DA6V(G) EAVH16S23DA6V(G) EAVH16S18DA9W(G) EAVH16S23DA9W(G) EAVX16S18DA6V(G) EAVX16S23DA6V(G) EAVX16S18DA9W(G) EAVX16S23DA9W(G) English Tle of ontents
More informationGeographical and plant genotype effects on the formation of arbuscular mycorrhiza in Avena sativa and Avena nuda at different soil depths
Geogrphil nd plnt genotype effets on the formtion of rusulr myorrhiz in Aven stiv nd Aven nud t different soil depths Yng, F. Y., Li, G. Z., Zhng, D. E., Christie, P., Li, X. L., & Gi, J. P. (2010). Geogrphil
More informationSTORAGE OF HARDWOOD PLANTING STOCK: EFFECTS OF VARIOUS STORAGE REGIMES AND PACKAGING METHODS ON ROOT GROWTH AND PHYSIOLOGICAL QUALITY
No. 1 83 SORAGE OF HARDWOOD PANING SOCK: EFFECS OF VARIOUS SORAGE REGIMES AND PACKAGING MEHODS ON ROO GROWH AND PHYSIOOGICA QUAIY D. P. WEBB nd F. W. von AHEN Gret kes Forest Reserch Centre, P.O. Box 49,
More informationVigor control in McIntosh apple trees by growth inhibitors
Vigor control in McIntosh pple trees y growth inhiitors L. Rufto 1, A.F. Brighenti 1, A.D. Rufto 2, L.I. Dominguez 3 nd T.L. Roinson 3 1Snt Ctrin Stte University (UDESC), College of Agric. nd Life Science,
More informationMessa, Cameroon. Received 19 October, 2016; Accepted 22 January, 2017
Vol. 11(8), pp. 331-340, August 2017 DOI: 10.5897/AJPS2016.1487 Artile Numer: 03673C665313 ISSN 1996-0824 Copyright 2017 Author(s) retin the opyright of this rtile http://www.emijournls.org/ajps Afrin
More informationImprovement on Rooting Quality of Jatropha curcas Using Indole Butyric Acid (IBA)
Reserh Journl of Agriulture n Biologil Sienes, 5(4): 338-343, 2009 2009, INSInet Pulition Improvement on Rooting Qulity of Jtroph urs Using Inole Butyri Ai (IBA) Noor Cmelli, N.A.,Thohirh, L.A., N.A.P
More information1/13/2017. Pink Rot Management. Pythium leak. Pink rot. Walt Sparks. Phytophthora erythroseptica. Pink Rot and Pythium Leak. Combinations of the two
1/13/17 Pink Rot nd Pythium Lek A potto storge is NOT hospitl! Wlt Sprks Pink Rot Phytophthor erythrosepti Pythium lek Pink rot Pythium lek Pink Rot Mngement 1. Field seletion/rop rottion. Adjust soil
More informationDifferences in size and architecture of the potato cultivars root system and their tolerance to drought stress
Plnt Soil Environ. Vol. 63, 217, No. 4: 159 164 doi: 1.17221/4/217-PSE Differences in size nd rchitecture of the potto cultivrs root system nd their tolernce to drought stress Krystyn ZARZYŃSKA 1, *, Dominik
More informationEffects of Irrigation Volume and Frequency on Shrub Establishment in Florida 1
Effects of Irrigtion Volume nd Frequency on Shru Estlishment in Florid E.F. Gilmn, C.L. Wiese 3, M. Pz 3, A.L. Shoer 4, S.M. Scheier 5, K.A. Moore 6, nd M. Brennn 7 Deprtment of Environmentl Horticulture
More information5200 series strike. Installation Instructions. Raising the Standards HES 2005
Rising the Stndrds 22630 North 17th Avenue Phoenix, Arizon 85027 Tehnil Support: 800.626.7590 support@hesinnovtions.om www.hesinnovtions.om 5200 series strike Instlltion Instrutions HES 2005 4059006.001
More informationSensitive Analysis of Passive Dehumidification System using Solar Heat
Sensitive Anlysis of Pssive Dehumidifiction System using Solr Het Hksung Lee 1, Akihito Ozki 2, Myonghyng Lee 3 1 Grdute student, Kyushu University, Fukuok, Jpn 2 Professor, Kyushu University, Fukuok,
More informationGAS VENT CATALOGUE - CANADA. MODEL RV - Small Diameter Round Vent. MODEL QC - Large Diameter Round Vent
GAS VENT CATALOGUE - CANADA MODEL RV - Smll Dimeter Round Vent MODEL QC - Lrge Dimeter Round Vent MODEL DWC - Flexile Doule Wll Connetor 04/02 Type B gs vent pipe tlogue for residentil, ommeril nd industril
More informationEffect of new organic fertilizers on growth of strawberry cv. Elsanta Preliminary results.
Effect of new orgnic fertilizers on growth of strwberry cv. Elsnt Preliminry results. Abstrct E. Mlus 1,2, L. Ss-Pszt 1, J. Ciesielsk 1 Vegettively propgted plnts of the strwberry cultivr Elsnt were grown
More informationEffect of Compost and Nitrogen Fertilizer on Basis of Morphological Characteristics of Citrus: Orange, Citrange and Sitromelo
Interntionl Journl of Frming nd Allied Sciences Aville online t www.ijfs.com 1 IJFAS Journl-1--1/17-17/ 1 Decemer, 1 ISSN -1 1 IJFAS Effect of Compost nd Nitrogen Fertilizer on Bsis of Morphologicl Chrcteristics
More informationPI: Amy Iezzoni Co-PI (2): Matt Whiting
FINAL PROJECT REPORT Projet Title: MSU herry rootstoks: Pre-ommeriliztion PI: Amy Iezzoni Co-PI (2): Mtt Whiting Orgniztion: Mih. Stte Univ. Orgniztion: Wsh. Stte Univ. Telephone: (17) 33-391 Telephone:
More informationBiological Control 56 (2011) Contents lists available at ScienceDirect. Biological Control. journal homepage:
Biologil Control 56 (2) 5 24 Contents lists ville t SieneDiret Biologil Control journl homepge: www.elsevier.om/lote/yon Compost mendments enhne pet suppressiveness to Pythium ultimum, Rhizotoni solni
More informationHydraulic resistance components of mature apple trees on rootstocks of different vigours
Journl of Experimentl Botny, Vol. 58, No. 15/16, pp. 4213 4224, 2007 doi:10.1093/jxb/erm281 This pper is vilble online free of ll ccess chrges (see http://jxb.oxfordjournls.org/open_ccess.html for further
More informationEffect of rice husk Biochar (RHB) on some of chemical properties of an acidic soil and the absorption of some nutrients
JASEM ISSN 1119-8362 All rights reserve Full-text Aville Online t https://www.jol.info/index.php/jsem http://ww.ioline.org.r/j J. Appl. Sci. Environ. Mnge. Vol. 22 (3) 313 317. Mrch 2018 Effect of rice
More informationDifferences in spatial and temporal root lifespan of three Stipa grasslands in northern China
Biogeochemistry (2017) 132:293 306 DOI 10.7/s10533-017-0302-4 Differences in sptil nd temporl root lifespn of three Stip grsslnds in northern Chin W. M. Bi. M. Zhou. Y. Fng. W. H. Zhng Received: 20 April
More informationPersistence of the systemic activity of metalaxyl and fosetyl-al applied as a soil drench or foliar spray to control Phytophthora crown rot of peach
Phytopthol. Mediterr. (2002) 41, 28 32 Persistence of the systemic ctivity of metlxyl nd fosetyl-al pplied s soil drench or folir spry to control Phytophthor crown rot of pech THOMAS THOMIDIS Ntionl Agriculture
More informationThe Effect of a green roof on thermal comfort and learning performance in a naturally ventilated classroom in a hot and humid climate
The Effect of green roof on therml comfort nd lerning performnce in nturlly ventilted clssroom in hot nd humid climte Spekers: Hung, Wen-Pin 1 ; Ruey-Lung, Hwng 2 ; Kuo-Tsng Hung 3 1 Feng Chi University,
More informationUser reference guide. Daikin room air conditioner CTXA15A2V1BW FTXA20A2V1BW FTXA25A2V1BW FTXA35A2V1BW FTXA42A2V1BW FTXA50A2V1BW
CTXA15A2V1BW FTXA20A2V1BW FTXA25A2V1BW FTXA35A2V1BW FTXA42A2V1BW FTXA50A2V1BW CTXA15A2V1BS FTXA20A2V1BS FTXA25A2V1BS FTXA35A2V1BS FTXA42A2V1BS FTXA50A2V1BS CTXA15A2V1BT FTXA20A2V1BT FTXA25A2V1BT FTXA35A2V1BT
More informationScale Effect on Runoff from Filed Plots under Natural Rainfall
Amerin-Eursin J. Agri. & Environ. Si., (9): 48-5, 0 ISSN 88-6769 IDOSI Pulitions, 0 DOI: 0.589/iosi.ejes.0..09.68 Sle Effet on Runoff from File Plots uner Nturl Rinfll 3 F. Aszeh, M. Gorji, A. Vezi, R.
More informationOperation manual. Daikin room air conditioner FTXF20A2V1B FTXF25A2V1B FTXF35A2V1B FTXF50A2V1B FTXF60A2V1B FTXF71A2V1B
Opertion mnul Dikin room ir onditioner FTXF20A2V1B FTXF25A2V1B FTXF35A2V1B FTXF50A2V1B FTXF60A2V1B FTXF71A2V1B Opertion mnul Dikin room ir onditioner English Tle of ontents Tle of ontents 1 Aout the doumenttion
More informationThe effect of plant hormone gibberellic acid on germination indices Secale montanum in vitro and pot experiments under drought conditions
Aville online t www.scholrsreserchlirry.com Annls of Biologicl Reserch, 2013, 4 (6):1-9 (http://scholrsreserchlirry.com/rchive.html) ISSN 0976-1233 CODEN (USA): ABRNBW The effect of plnt hormone gierellic
More informationSNA Research Conference Vol Growth Regulators Yan Chen Section Editor Plant Growth Regulators
Growth Regultors Yn Chen Section Editor Plnt Growth Regultors 152 Mnging Knock Out Rose nd Loropetlum Growth in the Lndscpe with Cutless.33G Yn Chen, Allen Owings, Regin Brcy, Joey Queedeux 21549 Old Covington
More informationEvaluation of Willow Propagation Methods FHWA Canyonville 5 Project
Evlution of Willow Propgtion Methods FHWA Cnyonville 5 Project Dvid Steinfeld November 2007 Summry: Willows tht were plnted s rooted cuttings becme estblished t much greter rte thn those from live stkes
More informationEffect of Growing Factors on Productivity and Quality of Lemon Catmint, Lemon Balm and Sage under Soilless Greenhouse Production: I.
Mediinl nd Aromti Plnt Siene nd Biotehnology 2 Glol Siene Books Effet of Growing Ftors on Produtivity nd Qulity of Lemon Ctmint, Lemon Blm nd Sge under Soilless Greenhouse Prodution: I. Drought Stress
More informationWelfare and Biodiversity Tradeoffs in Urban Open Space Protection
Welfre nd Biodiversity Trdeoffs in Urbn Open Spe Protetion Liil Tibev Deprtment of Applied Eonomis University of Minnesot St. Pul, MN Emil: ti0004@umn.edu Robert G. Hight USDA Forest Servie, Northern Reserh
More informationDESIGN APPROACH à LIGHT HAZARD:
GENERL NOTES - FIRE PROTETION 61G15 F OMPLINE NOTES: () ESIGN PPROH à LIGHT HZR: PIPE TO NEW SPRINKLER à à (5) FIRE PROTETION SYSTEM ENGINEERING OUMENTS THE ONSTRUTION OUMENTS OMPRISE THE FIRE PROTETION
More informationManagement Approaches for Thrips and Garden Symphylans in Lettuce
REPORT 1: Grden symphyln Project Title Mngement Approches for Thrips nd Grden Symphylns in Lettuce Project Investigtor Dr. Shimt Villnssery Joseph IPM Entomology Advisor University of Cliforni Coopertive
More informationTHE NITROGEN NUTRITION OF THE PEACH TREE. [Manuscript received August 8, 1966] Summary
THE NTROGEN NUTRTON OF THE PEACH TREE. * STORAGE AND MOBLZATON OF NTROGEN N YOUNG TREES By B. K. TAYLORt nd THE LATE L. H. MAY:j: [Mnuscript received August 8, 1966] Summry The chemicl composition nd distribution
More informationThe effect of tractor wheeling on the soil properties and root growth of smooth brome
Vol. 60, 2014, No. 2: 74 79 Plnt Soil Environ. The effect of trctor wheeling on the soil properties nd root growth of smooth brome K. Krebstein 1, K. von Jnowsky 2, J. Kuht 1, E. Reintm 1 1 Institute of
More informationNUTRIENT UPTAKE BY HYBRID POPLAR IN COMPETITION WITH WEED SPECIES UNDER GROWTH CHAMBER AND FIELD CONDITIONS USING THE SOIL SUPPLY AND NUTRIENT
NUTRIENT UPTAKE BY HYBRID POPLAR IN COMPETITION WITH WEED SPECIES UNDER GROWTH CHAMBER AND FIELD CONDITIONS USING THE SOIL SUPPLY AND NUTRIENT DEMAND (SSAND) MODEL A Thesis Submitted to the College of
More informationManaging Soilborne Diseases Through Removal of Root Inoculum in Red Raspberry
Mnging Soilborne Diseses Through Removl of Root Inoculum in Red Rspberry L.W. DeVetter1, I. Zsd2, J. Weilnd2, T. Wlters3, R. Rudolph4, S. Wtkinson5, Mrk Mzzol6, nd Suzette Glinto7 1Assistnt Professor,
More informationBIOAG PROJECT PROGRESS REPORT 2012 TITLE: PHYTONUTRIENTS AND GENOMICS OF ORGANIC TOMATOES: SOIL FERTILITY AND/OR PLANT DEFENSE
IOG PROJECT PROGRESS REPORT 2012 TITLE: PHYTONUTRIENTS ND GENOMICS OF ORGNIC TOMTOES: SOIL FERTILITY ND/OR PLNT DEFENSE PRINCIPL INVESTIGTORS ND COOPERTORS: PIS Preston ndrews nd mit Dhingr Coopertors
More informationUnderstanding the development of roots exposed to contaminants and the potential of plant-associated bacteria for optimization of growth
Annls of Botny 110: 239 252, 2012 doi:10.1093/o/mcs105, ville online t www.o.oxfordjournls.org RESEARCH IN CONTEXT: PART OF A SPECIAL ISSUE ON ROOT BIOLOGY Understnding the development of roots exposed
More informationRunning head: Utility of root cortical cell file number under drought Corresponding author: Jonathan P. Lynch, Department of Plant Science, The
1 2 3 4 5 Running hed: Utility of root corticl cell file numer under drought Corresponding uthor: Jonthn P. Lynch, Deprtment of Plnt Science, The Pennsylvni Stte University, University Prk, PA, USA 16802,
More informationEffect of Topping Height and Timing on Quantity and Quality Influe-Cured Tobacco (Var.K326)
Avilble online t http://www.ijbbr.com Interntionl journl of Advnced Biologicl nd Biomedicl Reserch Volume 2, Issue 4, 2014: 1388-1395 Effect of Topping Height nd Timing on Quntity nd Qulity Influe-Cured
More informationSCREENING FOR IRON CHLOROSIS TOLERANCE OF IN VITRO PYRUS ROOTSTOCK GERMPLASM
SCREENING FOR IRON CHLOROSIS TOLERANCE OF IN VITRO PYRUS ROOTSTOCK GERMPLASM Sugae Wada, Department of Hortiulture, Oregon State University, 4017 Agriulture & Life Siene Bldg. Corvallis Oregon 97331-7304
More informationAsparagus. Tuesday morning 9:00 am. Moderator: Gene Kokx Jr., Michigan Vegetable Council Board of Directors. 9:00 a.m. Asparagus Virus Survey
Asprgus Tuesdy morning 9: m Modertor: Gene Kokx Jr., Michign Vegetble Council Bord of Directors 9:.m. Asprgus Virus Survey Norm Myers, Ocen Co. MSU Extension 9:15.m. Asprgus Disese Updte Mry Husbeck, Plnt
More informationTable of Contents. Executive Summary. Results-at-a-Glance. Acknowledgements. List of Tables. List of Figures. Introduction 1.
Protocol for Irrigtion of Shrubs During Estblishment: Estblishing Best Mngement Irrigtion Prctices for Shrub Estblishment in Florid Lndscpes Edwrd F. Gilmn, Professor; Christine Wiese, Biologist; Amy Shober,
More information