Masterproef Exploring the role of plant hormones in root developmental responses to metal-stress

Transcription

1 FACULTEIT GENEESKUNDE EN LEVENSWETENSCHAPPEN mster in de iomedische wetenschppen: milieu en gezondheid Msterproef Exploring the role of plnt hormones in root developmentl responses to metl-stress Promotor : dr. Tony REMANS De trnsntionle Universiteit Limurg is een uniek smenwerkingsvernd vn twee universiteiten in twee lnden: de Universiteit Hsselt en Mstricht University. Stefnie De Smet Msterproef voorgedrgen tot het ekomen vn de grd vn mster in de iomedische wetenschppen, fstudeerrichting milieu en gezondheid Universiteit Hsselt Cmpus Hsselt Mrtelrenln 42 BE-3500 Hsselt Universiteit Hsselt Cmpus Diepeneek Agorln Geouw D BE-3590 Diepeneek

2 FACULTEIT GENEESKUNDE EN LEVENSWETENSCHAPPEN mster in de iomedische wetenschppen: milieu en gezondheid Msterproef Exploring the role of plnt hormones in root developmentl responses to metl-stress Promotor : dr. Tony REMANS Stefnie De Smet Msterproef voorgedrgen tot het ekomen vn de grd vn mster in de iomedische wetenschppen, fstudeerrichting milieu en gezondheid

3

4 Content Content... 1 Acknowledgements... 3 Astrct... 5 Astrct - Nederlnds... 6 List of revitions Introduction Stress-Induced Morphogenic Responses of the roots Metl stress induced y, or Development of the root systems Involvement of phytohormones in root development under norml conditions Exploring the link etween the development of stress-specific root rchitectures nd phytohormones Mterils nd Methods Plnt mterils nd growth conditions Verifiction of mutted genotypes Preprtion of verticl gr pltes Root rchitecture nlysis Gene expression nlysis Smples RNA extrction Additionl DNse rection Purifiction nd concentrtion of RNA smples Constructing cdna with reverse trnscription Primer design Rel-time PCR Anlysis Sttistics Results nd discussion Verifiction of mutnt lleles Root rchitecture nlysis of i4-1 nd ein2-1 mutnts First ssessment : comprison with previously descried metl-specific phenotypes... 24

5 i4-1 mutnts re more sensitive to moderte exposure i4-1 mutnts re less sensitive to excess Roots of Ai4-1 did not show n ltered response to exposure Ein2-1 mutnts re more sensitive to stress Ein2-1 mutnts re sensitive to excess Roots of ein2-1 mutnts hd no ltered response to Discussion on VAPs experiments Gene expression nlysis in wild-type A. thlin Optimiztion of gene expression on smll root systems Results of the genes involved in jsmonte signlling Results of the genes involved in ethylene signlling Results of the genes involved in uxin signlling Results of the genes involved in ABA signlling Discussion on gene-expression experiment Conclusion Future perspectives References Appendix... i Appendix 1 - Phusion Hot Strt II High-Fidelity DNA Polymerse (Thermo scientific)... i Appendix 2 - Nucleospin RNA XS kit (Mchery-Ngel)... ii Appendix 3 - Turo DNA-Free kit (Life Technologies Europe)... iv Appendix 4 - Primescript RT regent kit TKR (10µl rection) (Clontech)... iv Appendix 5 Results of the VAPs experiment with i4-1 (ornge) nd wild-type (green)... v Appendix 6 Results of the VAPs experiment with ein2-1 (lue) nd wild-type (green)... ix

6 Acknowledgements In this section, I would like to tke the time to thnk everyone tht mde it possile to write this mster s thesis. Thnks to the finncil, cdemic nd technicl support of Hsselt University, the Centre of Environmentl Sciences (CMK), this thesis could e mde. First of ll, I wnt to thnk professor Ann ypers for giving me the opportunity to do my senior internship in this reserch group. Further, I would like to thnk her for ll the plesnt lectures she gve throughout my eduction nd her support during my mster. A very specil thnks goes to my supervisor dr. Tony Remns. I relly lerned lot, nd working with him ws lwys very fun. Thnk you for helping me to lern nd understnd ll the new techniques, processing nd interprettion of the dt nd forming conclusion. Although Tony is very populr in the l nd therefore is lwys very usy, he lwys mde time to help his students. So thnk you for spending your scrce time on my questions nd helping me to mke this thesis. I would lso like to thnk ll the other students, doctorte students nd postdocs for the plesnt tmosphere in the l! Thnk you Liset, my co-worker for the fun times in the sun, lso known s the G29, nd outside the university. Finlly I would like to thnk my friends nd fmily who hve helped, supported nd entertined my throughout my entire eduction. Thnk you Joep, Lur, Zoë nd mum nd dd of course!

7

8 Astrct Plnts possess high level of plsticity, especilly in the root system. This enles the plnts to djust their growth nd development ccording to chnging environment in order to survive. In light of the second green revolution the responses of the root hve received more ttention in order to increse iomss production with miniml input of scrce resources like wter nd fertilizers. Also during stress conditions, ltered root system rchitectures hve een found nd were nmed Stress-Induced Morphogenic Responses (SIMR). In this reserch project, the link etween metl stress nd the resulting SIMR of the root is investigted. Metls with different properties re studied to increse the proility of finding stress-specific responses. For this reson cdmium (), copper () nd zinc () were chosen: nd re essentil to the plnt, while is non-essentil element, nd nd re redox ctive, wheres is nonredox ctive in plnts. Previous reserch of the group Environmentl Biology (CMK, Hsselt University) hd reported metl-specific effects of these metls on the root system rchitecture of wild-type Aridopsis thlin. Both nd were found to increse the numer of outgrowing lterl roots, ut inhiited the elongtion of these lterl root more severely thn. cused stronger negtive effects on oth lterl root outgrowth nd elongtion. Given the involvement of phytohormones in growth nd development of the plnt, nd on reports of ltered phytohormone concentrtions during stress (including metl stress), this reserch project hypothesizes tht phytohormones form link etween metl stress nd specific root developmentl responses. To explore the involvement of phytohormones in these metl-specific SIMRs of the roots, the effects of metl exposure ws investigted in different mutnts of A. thlin. The mutnts hve disrupted hormone signlling pthwy: i4-1 hs dysfunctionl scisic cid (ABA) signlling pthwy nd ein2-1 is mutted in key component of the ethylene signlling. The effects of the three metls on the root system of the mutnts ws exmined nd compred to rections in the wild-type. The i4-1 mutnt ws more sensitive to moderte exposure nd less sensitive to excess. The response to the tretment did not result in different root system rchitecture thn tht of the wild-type. The root system of ein2-1 seemed to e more sensitive to nd thn the root system of the wild-type. The gene expression of mrker genes of hormonl signlling pthwys ws exmined in wild-type A. thlin, exposed to, nd. The mrker genes were selected mong endpoints of hormonl signlling tht hve een shown to e trnscriptionlly induced., nd were found to lter the gene expression of mrker genes of every hormone. Except for, which did not lter the expression level of ny of the tested ethylene responsive genes? The results re indictive of the involvement of ABA-signlling through ABI4 in -specific responses nd ethylene-signlling through EIN2 in -specific responses of lterl root elongtion. ABI4 nd EIN2 re oth suspected to e involved in the -specific responses. The -specific effects on lterl root numer re proly ABI4-medited, while ethylene-signlling through EIN2 tkes plce in the effects of on lterl root elongtion. The nture of hormone involvement in the metl-specific root responses however remins uncler nd needs to e further investigted.

9 Astrct - Nederlnds Plnten ezitten een hoge plsticiteit, die prominent nwezig is in het wortelsysteem. Hierdoor kunnen plnten hun groei en ontwikkeling npssen n een vernderende omgeving, en dus kunnen overleven in deze nieuwe omgeving.. In het kder vn de tweede groene revolutie heen deze wortelresponsen meer ndcht gekregen om de iomss productie te kunnen verhogen met een minimle input vn schrse middelen zols wter en meststoffen. Het gewijzigde wortelsystem werd enoemd ls Stress-Induced Morphogenic Responses (SIMR), of stress geïnduceerde morfogene responsen vn de wortels. In dit onderzoek wordt de link tussen metlstress en het resulterende SIMR vn het wortel systeem onderzocht. Om de kns te verhogen dt in deze studie metl-specifieke SIMRs werden gevonden, werden metlen met verschillende eigenschppen. Hierom zijn cdmium (), koper () en zink () gekozen: en zijn essentieel voor de plnt, terwijl een niet-essentieel element is, en en zijn redoxctief, terwijl niet-redoxctief is in de plnt. Vorig onderzoek in de groep Milieuiologie (CMK, Universiteit Hsselt) heen reeds metl-specifiek effecten vn deze metlen op de wortels vn wild-type Aridopsis thlin gerpporteerd. Zowel ls verhoogde het ntl lterle wortels, mr inhieerde the elongtie vn deze lterle wortels ernstiger dn. veroorzkte meer negtieve effecten op lterle uitgroei en elongtie. Door de etrokkenheid vn fytohormonen in de groei en ontwikkeling vn de plnt enerzijds en meldingen vn een vernderde concentrtie vn fytohormonen onder stress (inclusief metlstress) nderzijds, wordt in dit onderzoek gehypothetiseerd dt fytohormonen een link vormen tussen metlstress en specifieke wortel ontwikkelingsresponsen. Om the etrokkenheid vn fytohormonen in deze metl-specifieke SIMRs vn de wortels te estuderen werden de effecten vn de metllootstelling in verschillende mutnten vn A. thlin onderzocht. De mutnten hdden een onderroken hormoon signlling pthwy : i4-1 hd een disfunctioneel scisinezuur (ABA) signlling pthwy en ein2-1 hd een muttie in een sleutelcomponent vn de ethyleen signlling pthwy. De effecten vn de drie metlen op het wortelsysteem vn de mutnten werd estudeerd en vergeleken met rectie in het wild-type. De i4-1 mutnten ws sensitiever voor gemtigde concentrties en minder gevoelig op overtollige lootstelling. De respons op de ehndeling resulteerde niet in een gewijzigde wortelrchitectuur ten opzichte vn het wild-type. Het wortelsysteem vn ein2-1 leek sensitiever voor en dn het wortelsysteem vn het wild-type. De genexpressie vn merkergenen vn de signlling pthwys vn de hormonen werd onderzocht in lootgestelde wildtype A. thlin. De merkergenen werden geselecteerd onder de eindpunten vn hormonle signleringen wrvn geweten is dt hun trnscriptie geïnduceerd wordt., en eïnvloedde de genexpressie vn de merker genen vn elk hormoon. Behlve, deze kon de expressie vn ethyleen responsieve genen niet eïnvloeden. De resultten indiceren de etrokkenheid vn ABA-signlling vi ABI4 in specifieke responsen en ethyleen-signlling vi EIN2 in specifieke responsen vn de lterle wortel elongtie. Er wordt gedcht dt ABI4 en EIN2 eide etrokken zijn in de specifieke respons. De specifieke effecten op het ntl lterle wortels zijn wrschijnlijk gemedieerd door ABi4, terwijl de EIN2 tussenkomt in de effecten op lterle wortel elongtie. De mnier wrop de hormonen etrokken zijn in de metl specifieke responsen lijft onduidelijk en moet verder onderzocht worden.

10 List of revitions A. thlin Aridopsis thlin ABA scisic cid ABI4 ABA Insensitive 4 ACC 1-minocyclopropne-1-croxylic cid BLAST Bsic Locl Alignment Serch Tool Cdmium cdna complementry Deoxyrionucleic cid SO 4 Cdmium sulphte CMK Centre for Environmentl Sciences COI1 Corontine Insensitve 1 Copper SO 4 Copper sulphte DZ differentition zone EIN2 Ethylene Insensitive 2 EZ elongtion zone gdna genomic deoxyrionucleic cid IAA indole-3-cetic cid K 2 SO 4 Potssium sulphte KOH Potssium hydroxide LOX lipoxygense LRP Lterl Root Primordium MES 2-(N-morpholino)ethnesulfonic cid MZ meristemtic zone NASC Nottinghm Aridopsis Stock Centre PCR Polymerse chin rection PR Primry Root QC Quiescent Centre qpcr quntittive PCR qrt-pcr quntittive reverse trnscription PCR RAM Root Apicl Meristem RG Reference Gene SIMR Stress-Induced Morphogenic Responses TAIR The Aridopsis Informtion Resource TE uffer Tris-HCl N 2 -EDTA uffer TIR1 The Trnsport Inhiitor Response 1 VAPs Verticl Agr Pltes Zinc SO 4 Zinc sulphte

11

12 1 Introduction The glol world popultion exceeded 7 illion in With current growing rte of ± 1.10% per yer, the popultion will proly rech 8 illion in 2025 ( Consequently, our ever growing popultion gives rise to growing industry nd pollution. This ll contriutes to the reltive decrese in griculturl re, mking the growing demnds for food supply nd iomss production for energy difficult to e met. 1 Since mny re lredy struggling with fmine, the Interntionl Food Policy Reserch Institute hs lunched the 2020 Vision Inititive. Its primry gol is to rech sustinle food security for the whole popultion y 2020 nd to cut the numer of chroniclly undernourished people y 50% y 2015 ( Aout yers go the green revolution 2 ws initited in order to increse iomss production. It rought out stedy rise in food production s result of etter griculturl prctices nd the intensive use of fertilizers nd pesticides. However, in the ner future, griculture will fce wter deficits nd shortge of fertilizers (due to the limited reserve of phosphorus). 3 Consequently new pproch of optimizing plnt growth nd well-considered use of existing lnd, including mrginl lnd contining stress fctors or lcking nutrients, is necessry. The Second Green Revolution 3 focuses on incresing plnt efficiency while using miniml input of scrce resources like wter nd fertilizers. Specil ttention is pid to plnt root systems ecuse they re responsile for severl vitl functions such s (1) nutrient nd wter uptke, (2) nchorge of the plnt in the sustrte (3) nd interction with symiotic orgnisms Stress-Induced Morphogenic Responses of the roots Plnts possess high developmentl plsticity, prticulrly in the root system, which enles them to djust their growth to chnging environments. 6 8 This is essentil to for the survivl of these sessile orgnisms, since they re not le to escpe from dverse environmentl conditions. The roots cn sense the physicl nd chemicl heterogeneity of the soil, thus when fced with stress they will djust their growth nd development ccordingly. 9,10 These Stress- Induced Morphogenic Responses (SIMRs) 11,12 of the roots hve een studied for vriety of iotic nd iotic stresses like drought, slinity, su-optiml tempertures nd nutrient deficiencies. 6,8,9,12 14 Mny studies hve reported reduced primry root elongtion nd incresed lterl root density for different stresses. Therefore Potters et l. (2009) 11 postulted tht vrious stresses ll result in similrly ltered root rchitecture system. The pplied im of these studies ws to optimize plnt growth when nutrients re scrce, or when plnts re fced with drought or slt stress, since lrge griculturl res re fcing these prolems or will fce them in the ner future. However, lrge res tht re contminted with excess metls, like cdmium (), copper () nd zinc (), exist s well, due to griculturl nd industril prctices. 12 Metl contmintion is very common nd widespred type of pollution tht forms mjor thret for generl pulic helth y direct exposure s well s ccumultion in the food chin. When plnts re exposed to excess metls, their growth is negtively influenced. 6,8,12 Wheres sustntil numer of studies hve een conducted to understnd the root responses to nutrient limittion or slt stress, 3,5,13,14 the effects of metl pollution on plnt 9

13 growth nd the underlying mechnisms remin poorly understood Given tht excess metls re heterogeneously distriuted in the soil, the positioning of the roots is n importnt determinnt of contminnt uptke. 12 Therefore the root system rchitecture is n importnt fctor when plnt growth needs to e optimized on contminted soils.. Thus, understnding the root responses to metls cn e considered s mjor priority in order to enle future optimiztion of plnt growth on metl contminted soils. The contminted soils cn e used for the purpose of either (1) sfe iomss production or (2) phytoremedition. This would contriute to sustinle use of otherwise unused res, tht re preferly used for food production, nd tke the pressure of griculturl fields. Becuse of the heterogeneous metl distriution, optiml root responses for sfe iomss production should include efficient voidnce mechnisms nd miniml systemic growth inhiition y the excess metls in order for the plnts to grow nd cpture nutrients within the most fvourle (lest contminted) soil ptches. As such, root system optimiztion with miniml contminnt uptke would led to sfe iomss production, e.g. energy iomss, on contminted fields. For the purpose of phytoextrction, on the other hnd, root growth needs to e stimulted in contminted res. Previous studies in the Environmentl Biology reserch group showed tht when roots were exposed to, or, different SIMRs were induced. 12 These findings contrdict the hypothesis y Potters et l. (2009) 11 tht different stresses trigger similr morphologicl outcomes. However, the description of the root system rchitecture in the findings of Potters et l. were limited to primry root growth nd lterl root densities, 11 indeed leding to similrities tht could e found etween mny stress conditions. By the inclusion of the lterl root growth rte s component of the root system rchitecture more detiled exmintion of the SIMRs cn e formed. So fr lterl root outgrowth hs received little ttention, lthough it is mjor determinnt of the root system rchitecture. 12 However, the effect of excess metls on lterl root elongtion nd root growth redistriution hs not een studied thus fr. 1.2 Metl stress induced y, or Previous reserch of the group Environmentl Biology (CMK) reported metl-specific effects of, nd on root system rchitecture of the model plnt Aridopsis thlin. 12, nd were chosen ecuse they possess different chemicl properties nd since they re common pollutnts. By compring metls with different properties, metl-specific stress responses re explored. is non-essentil element nd it is non-redox ctive, while is essentil nd redox ctive nd is essentil ut non-redox ctive in plnts. Becuse is nonessentil element, it is toxic t very low concentrtions, wheres essentil metls s nd will exert toxic effects when they re present in excess. The results of the previous study showed tht nd oth cused n incresed numer of outgrowing lterl roots, ut inhiited the elongtion of these lterl roots more severely thn. Excess cused switch-off effect, with strong negtive effect on oth lterl root outgrowth nd elongtion. 12 Since these findings refute the hypothesis of Potters et l. (2009) 11 tht different stresses yield similr responses, the question wht could form the moleculr sis of the metl-stress specific root responses is rised. In order to comprehend the stress- 10

14 dependent chrcter of the root responses the current knowledge of the physiologicl nd moleculr spects of root development under iotic stress needs to e expnded. To orgnize their root development, plnts mke use of phytohormones. 5,15 20 Severl studies hve reported ltered phytohormone levels under stress conditions 5,21 23 nd phytohormones hve lso een found to e involved in SIMRs of roots under slt stress. 14,24 Therefore, the hypothesis of this reserch project is tht phytohormones form the intermediry link etween metls nd stress-dependent ltered root system rchitecture. 1.3 Development of the root systems Root structure cn e descried in rdil nd n picl-sl polrity (Figure 1). At the centre of the root lys the vsculr undle, consisting of phloem nd xylem, the conductive tissues of the plnt. The vsculr undle is surrounded y pericycle cells tht cn give rise to lterl root primordi. Next lyers re the endodermis, which forms selective rrier for ions nd the cortex tht provides protection nd mechnicl support. The epidermis encloses the other tissues nd contins the tricholst linege, which gives rise to root hirs. 25 Growth of the root tkes plce using stem cells originting from the Root Apicl Meristem (RAM). The RAM contins set of stem cells surrounding the Quiescent Centre (QC), group of non-mitoticlly ctive cells. This QC plys mjor role in orgnizing the meristem nd is essentil for the specifiction of the stem cell niche nd mintennce of the undifferentited stte of the surrounding stem cells. Stem cells locted on the lterl sides nd ove (shootwrds) of the QC differentite into vsculr, endoderml, corticl, epiderml nd lterl root cp (LRC) cells, wheres stem cells under the QC produce the columell root cp. 5,25 When the primry root grows, the stem cell niche t the root tip, protected y the root cp, is pushed further into the soil y the elongting cells. New cells tht re produced y the stem cells in the RAM will lter elongte nd differentite, leding to different zones in the root : meristemtic (MZ), elongtion (EZ) nd differentition zone (DZ) (Figure 1.B). 5 The oundries of the zones re defined y the loction of the cells in the corresponding developmentl stge, thus when the zones re oserved in growing root, their oundries long the root xis will djust. 5,25 For the development of lterl roots, lterl root founder cell locted in the pericycle linege ecomes primed y n uxin pulse. Once miniml threshold distnce etween the founder cell nd the root tip is reched, cell division of the founder cell is ctivted to form Lterl Root Primordium (LRP). The emergence of the LRP root through the prent root epidermis is thought to rise mostly y cell expnsion. Once the lterl root is emerged, its picl meristem is ctivted nd the lterl root egins to grow (Figure 1.C). 5 In summry, oth primry nd lterl roots grow due to meristemtic ctivity nd cell elongtion. the formtion of lterl roots is determined t three levels : (1) the priming of the founder cell in the sl MZ 26, (2) the ctivtion of LRP formtion in DZ nd (3) the ctivtion of the meristem. 11

15 A. B. Lterl root cp Epidermis Cortex Endodermis Pericycle Vsculr undle Differentition Zone Elongtion Zone QC Columell Meristemtic Zone C. c d e f g h Figure 1: Root histology nd development A. Different tissues of the A. thlin root pex, ech differently coloured. From most outer lyer to inside core: lterl root cp, epidermis, cortex, endodermis, pericycle, vsculr undle nd the quiescent centre (QC) nd columell in the tip. (Adpted from Snz et l. (2012) 25 ) B. Distinct development zones in the A. thlin root consisting of the meristemtic, elongtion nd differentition zone with growing lterl roots. (Adpted from Petrick et l. (2012) 5 ) C. Lterl root development in A. thlin: (Adpted from Fukki et l. (2007) 18 nd Petrick et l. (2012) 5 ) Before lterl root initition Lterl root initition : nticlinl division of pericycle cells c Divided cells re rdilly expnded = Stge I d Outer nd inner cell lyers re formed y periclinl divisions = Stge II e f g h Dome shpe of the LRP is pprent (three-lyered) = Stge III In stge IV the LRP ecomes four-lyered s result of periclinl divisions. During stge V, cells undergo nticlinl divisions, resulting in LRP tht egins to push through the cortex of the primry root. In Stge VI, the LRP strts to resemle mture root tip (epiderml, cortex nd endoderml cell lyers) = Stge VII Lterl root meristem is estlished 12

16 1.4 Involvement of phytohormones in root development under norml conditions Phytohormones re the most importnt endogenous modultors of root system development. 27 They ct t very low, su-micromolr concentrtions nd their iosynthesis is not restricted to specilized tissues. The influence they exert on the development of tissue is triggered y trnscriptionl reprogrmming of ffected cells. 28 The phytohormone levels chnge over the course of norml development, therey ltering intrinsic ptterns of growth nd development. 29 Furthermore it is known tht phytohormone levels re modulted in response to environmentl signls, therefore they cn e considered key components of response pthwys. 29 The overlpping hormone signlling pthwys, of developmentl nd response pthwys, cn provide the complexity tht is needed for regulting the initition of lterl root development, considering tht the root system is constntly integrting ll informtion from different sources. 5,27,29 The interction etween phytohormones, referred to s crosstlk, cn e divided into direct nd indirect crosstlk, nd co-regultion (Figure 2). 28 Figure 2: Three different modes of phytohormone interctions (Adpted from Hoffmnn et l. (2011) 28 ) A. Direct crosstlk: developmentl/environmentl stimulus ffects the homeostsis of two or more phytohormones. The hormones will in turn ct on defined trget genes, triggering one response. B. Indirect crosstlk: stimulus ffects the homeostsis of one phytohormone, which will in turn ct on defined trget gene s well s the sensitivity/perception, undnce/metolism nd trnsport/sequestrtion of nother hormone. The effect on homeostsis cn either e positive or negtive nd this will lso ct on defined trget gene. C. Co-regultion: given stimulus cn ctivte two or more signlling pthwys, which seprte outcomes. The effect cn e dditive, synergistic, ntgonistic or they might not even interct t ll. This will led to comined response. This reserch project is focused on the ctions of uxin, ethylene, jsmontes nd scisic cid (ABA). These phytohormones re prt of signlling networks tht re involved in plnt development nd stress responses. 28,30 Auxin, under its most common form indole-3-cetic cid (IAA), is one of the most studied phytohormones. It plys n importnt role in mny spects of plnt growth nd development, including lterl root formtion, emryogenesis, mintennce of picl dominnce, shoot orgn formtion, vsculr formtion nd dventitious root formtion ,22,28 It hs een proven to 13

17 e key regultor of lterl root formtion, prticulrly during lterl root initition nd primordium development ,31 Strong evidence suggests tht the founder cell selection nd its division involves uxin. The exct site of lterl root initition is proly more consequence of uxin trnsport thn of de novo uxin synthesis. 17,27 Both cropetl nd sipetl uxin trnsport re required for LR formtion. 17,19 Overproduction of uxin or ppliction of exogenous uxin results in n incresed numer of initition events, 4,13,17,27,29 wheres uxin-resistnt mutnts disply decresed lterl root numer. 4,18,29,32 Using trnsgenic lines crrying the DR5 uxin responsive promoter coupled to the GUS or GFP reporter gene, the involvement of uxin redistriution ws pprent when A. thlin ws exposed to excess slt, or. 22,24 Ethylene (C 2 H 4 ) is gseous plnt hormone tht regultes plnt growth, development nd responsiveness to vriety of stresses. 33,34 Known ctions of ethylene re root growth inhiition nd root hir elongtion. 35 Studies found tht when ethylene ws dministered s its precursor 1-minocyclopropne-1-croxylic cid (ACC), it reduces cell elongtion in concentrtiondependent mnner. Cells with cesed elongtion cnnot recover, however when ACC ws removed newly formed cells showed no hrm from the tretment. 34 There is evidence of crosstlk etween ethylene nd uxin, ecuse severl uxin signlling mutnts of A. thlin were lso ethylene-insensitive, nd ecuse the expression of ACC-synthse is strongly uxininducile. 27 High concentrtions of ethylene (or ACC) inhiit lterl root initition y modifying uxin trnsport nd/or io-synthesis in specific cells in the treted roots. 19,34 Wheres, low concentrtions of ethylene promote lterl root initition y incresing uxin synthesis. 19 Jsmontes, including jsmonic cid nd its ioctive derivtives, inhiit root growth, regulte pollen development, defend ginst pests/pthogens nd respond to mechnicl wounding. 20,35,36 Jsmontes re oxylipins tht re synthesized y the oxygention of α-linolenic cid y the ction of lipoxygenses (LOXs). 30,37 It hs een shown tht ll jsmonte medited responses nlysed so fr required the jsmonte receptor COI1. 20,30 Both jsmontes nd ethylene stunt root growth nd oth re required for plnt defence responses to necrotrophic pthogens. 30 They disply n interesting crosstlk in which ethylene cn exert its inhiitory effect on root growth not only vi the norml pthwy of ethylene-receptors, ut lso y the jsmontes responsive COI1 pthwy. However, the ctions of ethylene in the COI1 pthwy did not present themselves when the plnts were plced in the drk. 35 Furthermore, it is suggested tht ethylene ntgonizes the jsmontes-induced inhiition of germintion. 35 There is lso growing evidence for sustntil indirect crosstlk etween uxin nd jsmontes. Auxin formtion in A. thlin is enhnced y jsmonte-medited induction of uxin iosynthesis genes nd uxin hs lso een reported to induce jsmonte production. 28 In the A. thlin root, indirect crosstlk etween uxin nd jsmontes is involved in the initition of lterl roots. Jsmonte-medited induction of IAA synthesis cn either led to the initition of lterl roots, ut ecuse of the dose-dependent effect of IAA it might s well result in growth inhiition. 17,28 Jsmontes cn modulte root development through n uxin-dependent nd - independent mnner. This ws shown when jsmonte-treted tir-mutnts (uxin resistnt) showed inhiition of the root growth. 20 ABA plys mjor role in stress responses, ut it lso hs essentil non-stress-relted regultory functions. 16 It is le to repress oth lterl root initition nd meristem ctivtion fter lterl root emergence nd it s seed dormncy nd drought response. 15,16,27,38 ABA-uxin 14

18 coregultionl crosstlk exerts itself in lterl root formtion. ABA-induced inhiition of lterl root formtion could not e rescued y uxin, suggesting tht there is n ABA-sensitive, uxin-independent checkpoint involved. 15,16,19,29 Also the ABI3 gene, encoding trnscription fctor necessry for ABA signlling, is uxin-inducile in LRP. 16,19,29 Evidence suggests tht ABA-induced root growth inhiition requires, t lest in prt, functioning ethylene signlling network. 16,24 Signlling crosstlk etween ABA nd jsmontes is thought to lnce compromise etween plnt growth nd defense. 28 This is reflected in the regultion of seed germintion, erly seedling growth nd the regultion of resistnce to different pthogens. 28,35,39 The hormonl influences on root development re pprent. As consequence it is interesting to investigte which phytohormones nd wht influences tke prt in the metl response. 1.5 Exploring the link etween the development of stress-specific root rchitectures nd phytohormones In this study the underlying moleculr prmeters involved in the metl-specific root growth responses to, nd will e determined in the model plnt Aridopsis thlin. This ojective will e met y exmining oth (1) the root rchitecture nd (2) the gene expression of severl mrker genes of hormonl signlling pthwys. A. thlin is used s model species, ecuse it llows n efficient comintion of genetic nd moleculr nlyses since moleculr dt on root growth under norml conditions is ville nd ecuse mutnts re ville. 40 Informtion otined for A. thlin my then e used for vlidtion in other species, e.g. A. thlin is closely relted to crop species from the Brssiccee fmily. 40 (1) Root rchitecture will e nlysed in reverse genetics pproch, in which the effect of gene knock-out is studied in ville mutnts. The effect of homogeneous exposure to, nd exposure on the root developmentl responses will e studied in these mutnts nd compred to the responses of wild-type A. thlin. The mutnts used re missing key component of the uxin, ethylene, jsmontes or ABA signlling pthwy. Using muttion in key protein of the signlling pthwy decreses the chnce of the pthwy eing completed vi prllel signlling route. For this study tir1-1 (uxin), ein2-1 (ethylene), coi1-1 (jsmontes), i4-1 (ABA) genotypes were selected. The Trnsport Inhiitor Response 1 (TIR1) protein is n uxin-signlling F-ox protein tht is required for the degrdtion of negtive regultors of the uxin response. 32 Muttions in this protein result in the ccumultion of Aux/IAA proteins, through which the norml uxin response is repressed. 18,32 Tir1 mutnts re uxin-resistnt nd therefore they disply vriety of growth defect like reduced lterl root formtion 19,20,28,32,41,42 Muttions in the Ethylene Insensitive 2 (EIN2) locus result in n insensitive phenotype to oth exogenous nd endogenous ethylene. Ein2 mutnts hve reduced germintion rte nd decresed root growth rte. 5,19,33,34,43 As mentioned erlier, ll jsmontes medited responses, nlysed so fr, required COI1. 20,30 Mutnts in Corontine Insensitive 1 (COI1) re unresponsive to jsmontes nd their growth phenotype is resistnt to the inhiition y JA. They show vrious degrees of mle sterility nd incresed susceptiility to pthogens/pests/fungi. 5,19,20,30,35,41,44 15

19 ABA Insensitive 4 (ABI4) is trnscription fctor involved in the response to ABA. Ai4 mutnts hve decresed sensitivity to the inhiitory ctions of ABA on germintion nd lterl root formtion, resulting in n incresed numer of lterl roots. 5,15,16,19,24,39,45 Although these mutnts my lredy show growth defects compred to wild-type plnts under norml conditions, genotype*tretment interction will revel the involvement of prticulr signlling pthwy in the metl-induced responses. (2) The gene expression of mrker genes of hormonl signlling pthwys ws exmined in wild-type A. thlin exposed to excess, nd, y quntittive reverse trnscription PCR (qrt-pcr). The mrker genes were selected mong endpoints of hormonl signlling tht hve een shown to e trnscriptionlly induced. A difference in gene expression of certin phytohormone responsive genes my then e indictive of the involvement of this phytohormone in the ltering of the root system rchitecture. 16

20 2 Mterils nd Methods 2.1 Plnt mterils nd growth conditions Aridopsis thlin ecotype Col-0 nd mutnts i4-1, ein2-1, coi1-1 nd tir1-1 were otined from NASC (Nottinghm Aridopsis Stock Centre). The genotype of mutnt plnts hd een verified y llele specific PCR efore strting the experiments (see elow). Seeds were surfcesterilized in 0.1% (w/v) NOCl nd 0.1% (v/v) Tween 80 for 1 min nd wshed four times with distilled wter over 20 min. After steriliztion they were cultivted on 12x12 verticl gr pltes contining modified 50x diluted Gmorg s B5 medium (see elow). Twenty seeds were sown on germintion pltes, which were fterwrds closed with prfilm. To llow ir exchnge, gp ws mde in the prfilm on oth sides of the plte. Pltes were incuted t 4 C in the drk for 2 dys efore eing trnsferred to the culture room to void heterogeneous germintion. Conditions in the culture room were 21 C nd 12h light per dy (150 µmol m - ² s -1 t lef level). A certin numer of dys fter incution (dependent on the experiment) plnts were trnsferred to tretment pltes t 5 plnts per plte. The medium in these tretment pltes ws supplemented with different concentrtions of SO 4, SO 4 or SO 4. The top cm of the solid medium ws removed to ensure plnts were solely exposed to the metls vi the roots. Pltes were closed with prfilm, two gps were mde nd they were plced ck into the culture room. 2.2 Verifiction of mutted genotypes A smll lef smple of every mutnt plnt used in seed production, nd mixed smple of severl wild-type A. thlin plnts ws dded into 20 µl dilution uffer (Direct Plnt PCR kit, Thermo Scientific, Lfyette, USA). The plnt mteril ws disrupted using sterile pipet. Next, 0.5µl of the smple ws used s DNA templte in 50µl rection mix contining 10µl 5x Phusion High-Fidelity uffer, 1µl 10 mm dntps, 2.5µl forwrd primer (10µM), 2.5µl reverse primer (10µM), 0.5µl Phusion hot Strt II DNA polymerse nd 33µl RNse free wter. The primer sequences listed in Tle 1. Tle 1: Primer sequences for identifiction of the mutnts (in 5 to 3 direction) Mutnt Forwrd primer Reverse primer i4-1 GAGATCCGAGAGCCACGTAA CCACCGAACCAGCTAGAGAG coi1-1 CAAGGAATGGAGGACGAAGA TTGATTCACTTCCGGGACTC tir1-1 GGTGTGCAAGTCATGGTACG CGCAAAATCTTGACCAAACC Optiml nneling temperture ws first exmined y pplying temperture grdient from 61 C to 69.2 C. PCR ws then performed ccording to the mnufcturers protocol (Thermo Scientific, Lfyette, USA; Appendix 1), with the stndrd nneling temperture of 67 C for the i4-1 nd tir1-1primers nd 61 C for the coi1-1 primer pir. 10µl of the PCR product ws verified for single mplicons fter grose gelelectrophoresis (1% grose). The remining PCR product ws send to Mcrogen Europe (Amsterdm, Netherlnds) for purifiction nd sequencing. Sequencing dt were investigted for presence of the known point muttions indictive of the mutnt genotype. Seeds were hrvested from plnts with confirmed genotypes only, to e used in the experiments. It ws chosen to investigte the ein2-1 nd i4-1 in extenso. The mutnts tir1-1 nd coi1-1 hve een successfully genotyped nd seeds were hrvested for future experiments. The muttion in ein2-1 17

21 plnts tht delivered the seed stock for this experiment ws specified prior to this study, using 5 -GCGGAAGCTCAAATATGGAA-3 forwrd primer nd 5 -GCTTGTAGGAGCAGCTTTGG-3 reverse primer nd sequencing of the PCR product (Kerim Schellingen, Hsselt University, personl communiction). 2.3 Preprtion of verticl gr pltes Growth medium in the verticl gr pltes consisted of 50 times diluted Gmorg s B5 medium, with djusted SO 4 concentrtion to void deficiency. Detiled composition of the medium is shown in Tle 2. Compound Tle 2: Composition of 50x diluted Gmorg's B5 medium Finl Concentrtion (µm) Compound Finl Concentrtion (µm) (NH 4 ) 2 SO 4 20 SO 4.5H 2 O MgSO 4 20 SO 4.7H 2 O CCl 2 20 N 2 MoO4 2H 2 O NH 2 PO 4.2H 2 O 20 CoSO 4.H 2 O 21 KNO KI H 3 BO FeNO 3.9H 2 O 2 MnSO 4.H 2 O All pltes contined 0.5g l -1 2-(N-morpholino)ethnesulfonic cid (MES) uffer, 10 g l -1 plnt tissue culture gr nd were djusted to ph 5.8 with KOH. Medium destined for germintion pltes ws enriched with 5g l -1 sucrose. Verticl gr pltes were prepred y dding 40 ml utoclved gr medium t 60 C to 12x12 squre petri dishes. Pltes were left open in the lminr irflow until the medium hd solidified. In tretment pltes 400 µl of 100x metl solution (SO 4, SO 4 or SO 4 ) ws dded to 40 ml medium. All pltes were supplemented with K 2 SO 4 to estlish constnt sulphte concentrtion in every plte. Tretment pltes were mde in triplicte. 2.4 Root rchitecture nlysis Five 7-dy-old seedlings with root length of pproximtely 2 cm were trnsferred to tretment pltes. Tretments for nd exposure were 0µM, 2µM, 5µM, 7.5µM nd 10µM s sulphte slts. Ech plte received totl SO 4 2- concentrtion of 10µM y K 2 SO 4 supplementtion. Tretments for were 0µM, 20µM, 50µM, 75µM nd 100µM, ech supplemented to 100µM SO After trnsfer to tretment pltes, the position of the primry root tip ws mrked nd pltes were scnned t 300 dpi (Epson scnner) dily. If tngled, roots were seprted using sterile toothpick to improve the qulity of the scn for nlysis. Shoots were cut nd plced flt on the gr t the end of the experiment to imge shoot surfce re. After completing the experiment ll dt ws extrcted from the scns using Optims Imge Anlysis Softwre y mesuring (1) primry root growth per dy, utilizing the dily mrkings, (2) lterl root length, (3) coordintes of the emergence point on the primry xis of ll the lterls, coordintes of the se of the root nd root tip t the dy of trnsfer nd (4) totl shoot re of ech plnt. Using Microsoft Excel 2010, ein2-1 nd i4-1 mutnts were compred to wild-type A. thlin in seprte experiments. Ein2-1 mutnts were monitored for 6 dys, i4-1 mutnts were monitored for 7 dys. 18

22 2.5 Gene expression nlysis Smples A. thlin Col-0 seedlings were trnsferred 7 dys fter incution to tretment pltes contining 75µM K 2 SO 4 ( pltes), 5µM SO 4, 5µM SO 4 or 75µM SO 4 (Finl SO 2-4 concentrtion in nd pltes ws supplemented to 75µM using K 2 SO 4 ). Roots were hrvested fter 1, 2 nd 3 dys of exposure t 6 iologicl smples per condition (mking totl of 72 smples), with ech smple consisting of 20 root systems. RNA extrction RNA ws extrcted using the Nucleospin RNA XS kit (Mchery-Ngel, Düren, Germny; Appendix 2), with n on-column DNse rection. The elution step ws executed in duplicte using 12 µl RNse free wter. To evlute the efficiency of DNA removl in the RNA smples, qpcr ws run with the first elutes of every smple together with dilution series of cdna nd gdna for comprison. The on-column DNse ctivity turned out insufficient, therefore n dditionl DNA removl ws performed. Additionl DNse rection To cler the reminders of genomic DNA in the smples nd dditionl DNse rection ws performed using the Turo DNA-Free kit ccording to the mnufcturers protocol (Life Technologies Europe, Gent, Belgium; Appendix 3), which lso included DNse inctivtion regent. Purifiction nd concentrtion of RNA smples RNA in the DNse treted nd DNse inctivted smples ws precipitted y dding 1/10 volume sodium-cette (3M), 0.1µl glycogen nd 2.5 volumes 100% (v/v) ethnol, wshed using 400 µl 70% (v/v) ethnol, nd resuspended in 8.5µl RNse free wter. RNA concentrtions nd purity (A260/A280; A260/A230) were mesured using the NnoDrop ND-1000 spectrophotometer (Nnodrop Technologies, Wilmington, USA). All smples were diluted with RNse free wter to otin finl RNA concentrtion tht corresponds with n RNA input in the next reverse trnscription step of 100ng in the smples with 1 dy of exposure nd 200ng in the smples with 2 nd 3 dys of exposure. Constructing cdna with reverse trnscription For the construction of cdna the Primescript RT regent kit TKR (10µl rection) ws used. The rection contined 2.0µl 5x PrimeScript Buffer, 0.5µl PrimeScript RT Enzyme Mix I, 0.5µl Oligo dt Primers (50µM) nd 0.5µl Rndom 6-mers (100µM) nd 6.5µl RNA smple. Reverse Trnscription- PCR (RT-PCR) ws performed ccording to the mnufcturers protocol (Clontech, Mountin View, USA; Appendix 4). Primer design New primers were designed for the POX, ARF3, ABI5, ABI3, ABI8, NAC1, DBP, AIR3, NAC2, AIR12 nd IAA19 genes. Gene sequences were otined from the TAIR10-gene dtse ( Primers pirs were preferly chosen so tht one primer tides over n exon-exon oundry nd tht oth primer nneling sites re present in every splice vrint the gene. 19

23 Primer pirs were serched using the we-sed progrm, Primer3 - version ( Using the Overlp Junction List option, primers contining n exon-exon oundry were specificlly trgeted. stom settings were used for Primer Tm (Min 59 Opt 60 Mx 61), Primer GC% (Min 40 Mx 60) nd Product Size Rnges (80-120). It ws verified tht the selected primers were only comptile with the corresponding gene nd its splice vrints y lsting the primer sequences to the TAIR trnscriptome nd genome. Finlly, primers were checked for self- nd hetero-dimeriztion using the we-sed progrm, OligoAnlyzer 3.1 ( Primer sequences of the mesured genes re listed in Tle 3. Rel-time PCR A tenfold dilution of the smples ws mde y dding 10x diluted TE Buffer (1mM Tris-HCl, ph 8.0, 0.1 mm N 2 -EDTA). In order to compre the gene expression of the cdna smples to dilution series, pooled smple ws mde, contining 5µl of every cdna smple. The pooled smple ws repetedly 2x diluted until 128x dilution ws reched. Gene expression ws mesured y rel-time PCR (qpcr) using the Fst SYBRgreen dye (Life Technologies Technologies Europ, Gent, Belgium). The rection contined 5µl 2x Fst SYBRgreen, 0.3µl forwrd primer (10µM), 0.3µl reverse primer (10µM), 2.4µl RNse free H 2 O nd 2µl cdna smple. Primer efficiencies were clculted sed on the Ct-vlues of the dilution series, ccording to Pfffl et l. (2004) 46 : Anlysis = 10!" The qpcr output ws nlysed using the 2 - Ct method with normliztion 46. The normliztion fctor ws comprised of four reference genes. Reference genes were evluted using the GeNorm 47 (version 3.5) softwre. Dissocition curves were checked to e indictive for single mplicons. 20

24 Tle 3: Genes mesured y qrt-pcr, their locus in the A. thlin genome, primer sequences nd chrcteristics. The primer sequences re presented in the 5 to 3 direction. Product size (p) of the cdna product is given for ech primer pir. Primer efficiency ws clculted sed on the Ct-vlues of the dilution series (optiml efficiency should e etween %). Genes tht were chosen s reference genes re indicted y RG in their nnottion informtion. Gene Locus Forwrd primer Reverse primer Product Size (p) Primer Efficiency Annottion SAND AT2G28390 AACTCTATGCAGCATTTGATCCACT TGATTGCATATCTTTATCGCCATC 61 82% RG : SAND fmily protein 48 YLS8 AT5G08290 TTACTGTTTCGGTTGTTCTCCATTT CACTGAATCATGTTCGAAGCAAGT 61 84% RG mitosis protein YLS8 48 UBIQ10 AT4G05320 GGCCTTGTATAATCCCTGATGAATAAG AAAGAGATAACAGGAACGGAAACATAGT 61 96% RG : uiquitin 48 EF-1α AT5G60390 TGAGCACGCTCTTCTTGCTTTCA GGTGGTGGCATCCATCTTGTTACA 76 77% RG : Elongtion Fctor 1α 48 LOX1 AT1G55020 TTGGCTAAGGCTTTTGTCGG GTGGCAATCACAAACGGTTC % Lipoxygense 12,49,50 LOX2 AT3G45140 TTTGCTCGCCAGACACTTG GGGATCACCATAAACGGCC % Lipoxygense 12,49,50 LOX3 AT1G17420 ACGTTGTCGTACTGGTCGCC GTCTCGTGGCACATACATAGGTAATG 91 75% Lipoxygense 12,49,50 LOX5 AT3G22400 GGCAAAACCGGCCGTAAAT GGCAAAACCGGCCGTAAAT 91 96% Lipoxygense 12,49,50 VSP2 AT5G24770 GGCGTGACCTACTGGAAGCA CGAGACTCTTCCTCACCTTTGACTT 91 79% JA responsive 30 MYC2 AT1G32640 GGCGTTGATGGATTTGGAGTT ACCCATCTTCACCGTCGCTT 91 90% JA responsive TF, ABA responsive 30 ERS1 AT2G40940 TAGAAAACGTGGCGGATCAGG TGCTCCATAAGCTGGTCACGA 92 94% Ethylene response sensor 1 35 ERS2 AT1G04310 AGTCTCAACGCTTGCCAAAACAT CAACTGAGACGCTTTTCACCAAAC % Ethylene response sensor 2 35 ETR2 AT3G23150 TTCGAACCGGGCAGTTACAC AATGGCGGTAAGGCAATCG 91 77% Ethylene response 2 35 ERF1 AT3G23240 TCCTCGGCGATTCTCAATTTT CAACCGGAGAACAACCATCCT % Ethylene response fctor 1 35 POX AT5G22140 CTAATATCCCTGAGATGAAACAAGG TCTTCTTTTTCCCACCTGACAT 99 81% 9-LOX responsive 49 NAC1 AT1G56010 TCTCTGAGCTCTCCAAAGGAA TGCAGAGGCTGTCTCATCAA % Erly uxin responsive 42,51 NAC2 AT5G39610 CCCCAAACAGCTAAGAACGA CCATTCGGTTAATGTGTGGA % Auxin responsive 42,51 IAA19 AT3G15540 TGTGGCCTTGAAAGATGGTGA TGCATGACTCTAGAAACATCCCC % Auxin, ABA responsive 27,31,52 DBP AT2G45820 GTTCGGCCGATAGAGATGTG-5 TCTTTTGTGCCCTGTTCTCA % Auxin responsive 42,53 AIR12 AT3G07390 ACAGCAGTCTCGTCGAAGGT GGAACCTTAACCGTCGTGAA % Auxin, ABA responsive 16,54 ABI5 AT2G36270 CGCGAGTCTGCTGCTAGATC CCTCTCCAACTCCGCCAATG % ABA responsive 16,39,55 ABI8 AT3G08550 GCTCGGGTTCAAGATCACCT GACAGCAGCCTCCTCCAATT 96 99% ABA responsive 16,39,55 21

25 2.6 Sttistics All sttisticl nlysis were conducted in R 56. Suspected outliers in the dt were sttisticlly verified using the Grus test nd we-sed tool ( In order to determine whether prmetric or non-prmetric test should e used, normlity nd homoscedsticity were tested. The dt mtrix ws lso trnsformed to squre-root, inverse, exponentil nd logrithmic dt mtrices. The Shpiro test ws performed on ech mtrix to find which mtrices hd norml distriution. The homoscedsticity vrinces of every mtrix were tested using the Brtlett test. Only if oth tests resulted in p-vlue>0.05, prmetricl test could e conducted. Prmetricl sttisticl nlysis of the originl dt mtrix ws preferred, however if the originl dt mtrix did not meet the criteri, nother dt mtrix tht did fulfil the criteri ws used in prmetric testing. Root rchitecture ssys were nlysed using prmetricl two-wy ANOVA (genotype nd tretment vriles), while for gene expression dt one-wy ANOVA (tretment vrile) ws used. Prmetricl two-y-two comprisons were done using the Tukey test HSD (Honestly Significnt Difference). Only when none of the dt mtrices could e tested prmetriclly, non-prmetric test ws performed using the originl dt. The homoscedsticity vrinces were non-prmetriclly tested y the Fligner test, gin the desired p-vlue exceeds Non-prmetric ANOVA (two-wy for root rchitecture nlysis nd one-wy for gene expression experiments) were mde using Kruskl-Wllis test nd the two-y-two comprisons y the Pirwise Wilcoxon rnk sum. 22

26 3 Results nd discussion 3.1 Verifiction of mutnt lleles As mentioned in Mteril nd Methods muttions in i4-1, coi1-1 nd tir1-1 mutnts were checked. The muttion in ein2-1 mutnts ( C to T sustitution t NT position 3448, leding to stop codon) ws previously verified in the reserch group nd ws therefore not repeted. Using the chromtogrm, the nture of the muttion ws exmined. Homozygous muttions were needed in i4-1 nd tir1-1 mutnts, while the muttion in coi1-1 hd to e heterozygote, ecuse of the mle sterility in homozygous plnts (Figure 3). These heterozygous plnts then segregte ¼ homozygous seeds tht cn e used for testing root growth responses. Ai4-1 mutnts were checked for single G deletion t NT position 469 of the coding sequence, leding to frmeshift. Muttion in tir1-1 consists of G to A sustitution t NT position 440. Coi1-1 muttions contined tryptophn to stop conversion s result of G to A sustitution t NT position 441. A. B. C. Figure 3: Chromtogrm frgment of the coi1-1 mutnt A. Homozygous wild-type: no muttion. B. Heterozygous G to A muttion: wnted heterozygous muttion. C. Homozygous G to A conversion: sterile phenotype 3.2 Root rchitecture nlysis of i4-1 nd ein2-1 mutnts In this experiment i4-1 mutnts were exposed to 0µM, 2µM, 5µM, 7.5µM nd 10µM or, nd to 0µM, 20µM, 50µM, 75µM nd 100µM for 7 dys. The ein2-1 mutnts were 6 dys exposed to the sme concentrtions, ut this experiment did not include the highest concentrtions (10µM, 100 µm). The term upper zone refers to the pre-existing first ± 2cm of the root system, while the lower zone refers to the prt of the root system tht ws grown fter the trnsfer of the seedlings to the tretment plte. For ech prmeter the smple size n will e given s n intervl since some plnts with n norml growth were discrded from the nlysis, with mximl smple size per concentrtion of 15 plnts. A selection of dt is presented in this section, grouping ll grphs tht supported the sme hypothesis, the remining dt cn e found in ppendix. Some technicl mlfunctions in the newly dopted culture room cused the lights to e permnently on for 3 dys insted of the norml 12h/12h light/drk cycle - during the ein2-1 experiment. This pprently cused norml root systems in the form of curly root growth nd overlpping, tngled lterl roots. Therefore sustntil numer of root systems were difficult to nlyse. The presented dt re sed on limited numer of root systems which were nlysle nd selected to e representtive for the tretment. Becuse of the remining smll smple size, the sttisticl nlyses in this experiments my not e representle for the iologicl effects nd re therefore not presented. Grphs of ein2-1 will e evluted for their indictionl vlue. No such prolems were encountered during the experiment using the i4-1 mutnts, nd full sttisticl nlysis is presented. 23

27 First ssessment : comprison with previously descried metl-specific phenotypes Prior to detiled exmintion, some indictive findings re compred with previous results on metl specific effects on root growth to check whether the dt re in ccordnce. The experiment with i4-1 showed tht the incresing exposure is trnslted to decresed growth of the primry root in wild-type plnts of this experiment (Figure 4.A) s well s in the mutnts (Figure 5). The grphs in Figure 4.A lso confirm tht homogeneous set of seedlings with the sme root length ws selected for trnsfer, s the primry root lengths of the upper zone re the sme. The totl lterl root length ws lso found to e inhiited y the exposure, with the treted plnts t 5-10µM exposure showing less strong inhiition thn nd treted plnts t higher concentrtions. (Figure 4.B) In the experiment with ein2-1 the effects tht were suspected in these prmeters re visile to some extent, however they re not s pprent s they were in the experiment conducted with i4-1, likely s consequence to the technicl prolems during this experiment. A. B. Men primry root length exposure (µm) Totl lterl root length exposure (µm) Men primry root length exposure (µm) Totl lterl root length exposure (µm) Men primry root length Totl lterl root length exposure (µm) exposure (µm) Figure 4: Indictive findings to check with previous results Men primry root length (A.) nd totl lterl root length (B.) of wild-type A. thlin exposed to, or. The effects on men primry root length re found in the lower zone, while in the totl lterl root length the effects re found in the upper zone. No sttistics re presented since this selection of grphs ws only used to verify whether the dt were in ccordnce with previous results. 24

28 i4-1 mutnts re more sensitive to moderte exposure The effects on the men primry root length of WT nd i4-1 (Figure 5) show tht the primry root growth decreses significntly with n incresing exposure. Ai4-1 seems to e slightly more sensitive to 2µM thn the wild-type. Although not significntly different here, this ltered sensitivity ws lso oserved in other prmeters (see elow nd reltive primry growth rte, Appendix 5). A. B. Men primry root length c exposure (µm) Men primry root length c exposure (µm) Figure 5: Men primry root length under exposure (focused on lower zone) Men primry root length of (A.) wild-type A. thlin nd (B.) i4-1 mutnts, fter 7 dys of exposure (0µM 10µM). Different letters indicte sttisticlly significnt differences within genotype nd zone (p< 0.05), fter Kruskl-Wllis test nd Pirwise Wilcoxon rnk sum test in two-wy ANOVA (n = 11-15). No significnt differences were found etween the effect on WT nd i4-1 exposed to the sme concentrtion. The totl lterl root length lso showed decrese with incresing exposure (Figure 6). This prmeter is significntly decresed in i4-1 when exposed to 2µM, while the wild-type did not disply significnt decrese here. However, when the totl lterl root length of the wild-type nd i4-1, oth exposed to 2µM, were compred, no significnt interction effect ws found. In this prmeter, the focus lies upon the upper zone. Mny lterl roots in the lower zone re still in the developing stge. These re still very smll nd cn therefore not e correctly nlysed on mcroscopic scle, while the roots in the upper zone hve lredy emerged from the epidermis of the primry root. A. B. Totl lterl root length exposure (µm) Figure 6: Totl lterl root length under exposure (focused on upper zone) Totl lterl root length of (A.) wild-type A. thlin nd (B.) i4-1 mutnts, fter 7 dys of exposure (0µM 10µM). Different letters indicte sttisticlly significnt differences within genotype nd zone (p< 0.05), fter Kruskl-Wllis test nd Pirwise Wilcoxon rnk sum test in two-wy ANOVA (n = 11-15). No significnt differences were found etween the effect on WT nd i4-1 exposed to the sme concentrtion. Totl lterl root length c c c exposure (µm) 25

29 The totl lterl root length is the result of men lterl root length nd men lterl root numer. The men lterl root length (Figure 7.A, B) hs significnt drop from 0µM to 2µM in oth wild-type nd i4-1, with significnt genotype*tretment interction difference etween wild-type nd i4-1 t 2µM exposure. Figure 7.C shows tht seems to hve stimulting effect on the men numer of lterl root in the wild-type, which chnges into significnt decrese fter 5µM. The pttern tht exposure rought out on the lterl root numer in wildtype plnts does lso reoccur in i4-1, ut the trend of stimultion ws less prominent. The significnt decrese in lterl length nd no significnt effect on lterl root numer of i4-1 exposed to 2µM, trnsltes into the significnt decrese of men totl lterl length of i4-1 t 2µM. When the effects etween wild-type nd i4-1 on men lterl root numer were compred, no significnt difference ws found. Thus, lthough the men totl lterl length could only find n indiction of i4-1 recting differently to 2µM, the men lterl root length could prove this to e significnt interction effect. A. B. Men lterl root length exposure (µm) Figure 7: Dividing totl lterl root length into its components: lterl length nd numer Men lterl root length of (A.) wild-type A. thlin nd (B.) i4-1 mutnts nd men lterl root numer of (C.) wild-type nd (B.) i4-1, fter 7 dys of exposure (0µM 10µM). Different letters indicte sttisticlly significnt differences within genotype nd zone (p< 0.05), fter Kruskl-Wllis test nd Pirwise Wilcoxon rnk sum test in two-wy ANOVA for the men lterl root length (A. nd B.) nd for men lterl root numer fter Prmetric ANOVA nd Tukey (n = 11-15). Letters in old, itlic represent significnt difference (p<0.05) etween wild-type nd i4-1 in tht concentrtion (genotype*tretment interction effect).this prmeter ws lso focused on the upper zone. In the prmeters longest lterl length nd the men length of lterls of ll plnts (Appendix 5), i4-1 seems to hve more severely decresed length thn the wild-type t 2µM, however this ws not sttisticl significnt difference (using Kruskl-Wllis test nd Pirwise Wilcoxon rnk sum test). The sme trend ws found in the men shoot re (Appendix 5), lso in this prmeter no Men lterl root length C. D. 11, 7,c c 3 Men lterl root numer c c c exposure (µm) Men lterl root numer - sttisticl difference ws found (using prmetric two wy ANOVA nd Tukey test). 11,, c c c exposure (µm) exposure (µm) c 26

30 The results indicte the involvement of ABA-signlling in the - specific root response. The lterl root elongtion ws more ffected y in the i4-1 mutnt thn in the wild-type, ut no distinct differences etween the genotypes were found in the lterl root numer. Therefore, it cn e concluded tht ABI4 is involved in the -specific ltertions of the lterl root length, ut not in effects on lterl root numer. Since the men shoot re shows the sme phenotype, it could e tht the shoot re is decresed ecuse of lower nutrient intke with the smller root system. Alterntively, stress effects in the shoot my interfere with photosynthesis, leding to decresed growth tht is stronger in i4 mutnts. 12,36 i4-1 mutnts re less sensitive to excess The sme prmeters s in the previous section were exmined under exposure. The men primry root length under stress lso showed significnt reduction with incresing exposure, ut no significnt differences were found etween wild-type A. thlin nd i4-1 (Appendix 5). The reltive growth rtes of the primry root (Appendix 5), suggested no differences in the response of the two genotypes, ut in the kinetic primry root length it seems tht i4-1 hs slightly ltered response t 50µM exposure (Figure 8). A. B. Men primry root length Dys fter trnsfer Men primry root length Dys fter trnsfer Figure 8: Kinetic primry root length under exposure (Totl root) Men primry root length of (A.) wild-type A. thlin nd (B.) i4-1 during 7 dys of exposure (0µM-10µM). No sttisticl nlysis ws performed on this prmeter, s the dt only serve n indictionl purpose. (n = 11-15) The totl lterl root length is clerly inhiited y the 50µM tretment (Figure 9.A, B). However the decrese is less prominent in i4-1 thn in the wild-type, suggesting tht the mutnt is less sensitive to the effect of excess. Compring the totl lterl root length etween the genotypes shows tht i4-1 ws significntly less ffected y 50µM thn the wild-type ws. In order to explin this effect, the components of the totl lterl root length were gin exmined seprtely (Figure 9). The men lterl root length lso showed the significnt decrese with incresing exposure, however this response did not differ etween the genotypes (Figure 9.C, D). The less sensitive phenotype of i4-1 is prominent in the lterl root numer (Figure 9.E, F). The effects of excess induced significnt drop in lterl root numer from 20µM to 50µM in the wild-type, ut not in i4-1. Also t 75 nd 100µM, i4-1 seems to hve more lterl roots thn wild- types. 27

31 A. B. Totl lterl root length Men lterl root length exposure (µm) C. D. Men lterl root numer exposure (µm) E. F., c c exposure (µm) d d c d d c Totl lterl root length Men lterl root length Men lterl root numer c d d exposure (µm) c d d exposure (µm) exposure (µm) Figure 9: Totl lterl root length nd its components: lterl length nd numer under exposure Focused on upper zone : totl lterl root length of (A.) wild-type A. thlin nd (B.) i4-1 mutnts; men lterl root length of (C.) wild-type nd (D.) i4-1 nd men lterl root numer of (E.) wild-type nd (F.) i4-1,fter 7 dys of exposure (0µM 100µM). Different letters indicte sttisticlly significnt differences within genotype nd zone (p< 0.05), fter Kruskl-Wllis test nd Pirwise Wilcoxon rnk sum test in two-wy ANOVA for totl nd men lterl root length (A.-D.) nd for men lterl root numer fter Prmetric ANOVA nd Tukey (n = 10-15). No sttistics re presented in the lower zone, s these dt re not relevnt. Letters in old, itlic represent significnt difference (p<0.05) etween wild-type nd i4-1 in tht concentrtion. 28

32 The prmeters longest lterl length nd men length of lterls of ll plnts did not found significnt difference etween i4-1 nd the wild-type (using reltively Prmetric two-wy ANOVA nd Tukey, nd Kruskl-Wllis test nd Pirwise Wilcoxon rnk sum test). The men shoot re showed no different response etween the genotypes. The previous reported 12 effect of decresing the lterl root numer in wild-type A. thlin ws lso found in this experiment. Interestingly, the decrese ws significntly less severe in i4-1 thn it ws in the wild-type. Consequently ABI4 is most likely involved in this -specific decrese in lterl root numer. Since the lterl length of i4-1 nd the wild-type were similrly ffected y, this response is not thought to e ABI4-medited. Roots of Ai4-1 did not show n ltered response to exposure All the previously discussed prmeters of root responses showed no difference etween the response of wild-type nd i4-1 plnts to exposure (Appendix 5. In conclusion, ABI4 is proly not involved in -specific root responses. The men shoot re decresed under exposure. At 5µM exposure, i4-1 hd significnt lower shoot re thn the wild-type, indicting tht i4-1 might e more sensitive to 5µM for this prmeter. Men shoot re (mm²) Col -0 Ai4-1 c c c c exposure (µm) Figure 10: Men shoot re under exposure Men shoot re (mm²) of wild-type A. thlin nd i4-1 mutnts, fter 7 dys of exposure (0µM 10µM). Different letters indicte sttisticlly significnt differences within genotype nd zone (p< 0.05), fter Kruskl-Wllis test nd Pirwise Wilcoxon rnk sum test in two-wy ANOVA (n = 11-15). Letters presented ove the curves correspond to Col-0 (wild-type) nd letters elow the curves correspond to i4-1. Letters in old, itlic represent significnt difference (p<0.05) etween wild-type nd i4-1 in tht concentrtion. Becuse the involvement of phytohormones differ in the shoot nd root, it is possile tht ABI4 is involved in the response of the shoot to stress. However, for more certinty on this hypothesis, different pproch nd more reserch is needed, tht ws not provided in the frmework of this report. 29

33 Ein2-1 mutnts re more sensitive to stress As expected, the primry root length decresed with incresing exposure (Figure 11 A,B). Ein2-1 mutnts seem to e more sensitive to stress thn the wild-type t 5µM. This is oserved in primry root growth nd totl lterl root length (Figure 11 C, D). A. B Men primry root length Primry root length (cm; focused on lower zone) of (A.) wild-type A. thlin nd (B.) ein2-1 mutnts nd the totl lterl root length (cm; focused on upper zone) of (A.) wild-type nd (B.) ein2-1 mutnts, fter 6 dys of exposure (0µM 7.5µM). No sttistics re presented, s the dt only serve n indictionl purpose. When totl lterl root length is divided into its components men lterl root length nd men lterl root numer, this trend is found gin (Figure 12). The men lterl root length is inhiited y the exposure nd ein2-1 seems to e more sensitive to 5µM thn the wild-type. There lso seems to e different response in the lower zone of ein2-1. Overll the men lterl root length of ein2-1 in the lower zone is slightly longer thn tht of the wild-type, with the most pronounced difference in 5µM. The men lterl root numer seems to e similrly effected in the wild-type nd in ein2-1. The prmeters longest lterl length nd men length of ll lterls lso presented more sensitive rection of ein2-1 to 5µM (Appendix 6). The results point to n involvement of EIN2 nd the ethylene signlling pthwy in the root responses to exposure. This involvement is found in the inhiitory effects of on the lterl root elongtion exposure (µm) Men primry root length C. D exposure (µm) exposure (µm) exposure (µm) Figure 11: Primry root length nd Totl lterl root length under exposure Totl lterl root length Totl lterl root length 30

34 Men lterl root length exposure (µm) A. B. Men lterl root length C. D. Men lterl root numer exposure (µm) Men lterl root numer exposure (µm) exposure (µm) Figure 12: Dividing totl lterl root length into its components: lterl length nd numer Men lterl root length of (A.) wild-type A. thlin nd (B.) ein2-1 mutnts nd men lterl root numer of (C.) wild-type nd (D.) ein2-1, fter 6 dys of exposure (0µM 7.5µM). No sttistics re presented, s the dt only serve n indictionl purpose. The sensitive phenotype of ein2-1 mutnts ws lso pprent in the effects of exposure on the men shoot re. The shoot re decreses with incresing exposure, however the shoot re in the wild-type seems to e stimulted y 2µM. (Figure 13) Possily, the shoot ws decresed s n effect of the decresed root system, ut it might e possile tht EIN2 is involved in - specific shoot responses s well. Men shoot re (mm²) Col-0 Ein exposure (µm) Figure 13: Men shoot re under exposure The men shoot re (mm²) of wild-type A. thlin nd ein2-1 mutnts, fter 6 dys of exposure (0µM 7.5µM). No sttistics re presented s this grphs is only used to form n indiction. Ein2-1 mutnts re sensitive to excess The primry root length is in oth genotypes inhiited y exposure. The primry root length of wild-type A. thlin nd ein2-1 mutnts show distinctive difference in the response of the genotypes to 50µM exposure (Figure 14). This distinction is lso prominent in the reltive kinetic primry root growth over 6 dys (Appendix 6). Although the growth ptterns found re irregulr nd stndrd errors re lrge (possily due to the norml growth conditions cused y period of permnent illumintion), the difference in response etween the genotypes to 50µM is rther lrge. 31

35 A. B. Men primry root length exposure (µm) Men primry root length exposure (µm) Figure 14: Men primry root length (cm; focused on lower zone) under exposure Primry root length of (A.) wild-type A. thlin nd (B.) ein2-1 mutnts, fter 6 dys of exposure (0µM 75µM). No sttistics re presented, s the dt only serve n indictionl purpose. The totl lterl root length of ein2-1 lso displyed n pprent ltered response to 50µM, in the endpoint nlysis s well s in the kinetic dt (Figure 15). A. B. Totl lterl root length exposure (µm) C. D. Totl lterl root length exposure (µm) men totl lterl length (Cm) Dys fter trnsfer men totl lterl length Dys fter trnsfer Figure 15: Endpoint nd kinetic totl lterl length under exposure (upper zone) Totl lterl length of (A.) wild-type A. thlin nd (B.) ein2-1 mutnts, fter 6 dys of exposure to (0µM 75µM) nd the kinetic dt of (C.) wild-type (D.) ein2-1 during these 6 dys of exposure. No sttistics re presented s the dt only serve n indictionl purpose. The components of the totl lterl length give the sme results: the men lterl root length nd numer re much lower in ein2-1 thn in the wild-type t 50µM exposure (Figure 16). Interestingly, the men lterl root numer t 75µM seems to e less effected in ein2-1 thn in the wild-type. All the oservtions were mde in oth endpoint nd kinetic nlyses of the different prmeters. Prmeters longest lterl length nd men length of lterls of ll plnts contriuted to the oservtion of more sensitive response of ein2-1 to 50µM (Appendix 6). Anlysis of the men 32

36 shoot re of wild-type A. thlin nd ein2-1 mutnts fter 6 dys of exposure, did not show ny differences etween the genotypes. A. B. Men lterl length exposure (µm) Men lterl length C. D exposure (µm) men lterl root length men lterl root length Dys fter trnsfer E. F. 14 Men lterl root numer 7 0 Men lterl root numer exposure (µm) G. H Dys ter trnsfer exposure (µm) men lterl root numer Dys fter trnsfer men lterl root numer Dys fter trnsfer Figure 16: Endpoint nd kinetic lterl root length nd numer under exposure (upper zone) Men lterl root length of (A.) wild-type A. thlin nd (B.) ein2-1 mutnts, fter 6 dys of exposure (0µM 75µM) nd kinetic dte of (C.) wild-type nd (D.) ein2-1 during these 6 dys of exposure. Men lterl root numer of (E.) wild-type nd (F.) ein2-1, fter 6 dys of exposure nd kinetic dt of (G.) wildtype nd (H.) ein2-1 during these 6 dys of exposure. Grphs serve s indictions, thus no sttistics re presented. In conclusion the ethylene signlling pthwy is proly involved in the -specific root responses. Becuse lot of different prmeters ll found tht the root length differed in the ein2-1 mutnt compred to the wild-type, the involvement of EIN2 in the -induced effect on lterl root elongtion is prole. The effect on the lterl numer however, is not s cler. Both endpoint nd kinetic 33

37 nlysis of the lterl root numer show more sensitive response of ein2-1 to 50µM ut less sensitive to 75µM, in comprison to the wild-type. This shift in rection cnnot e resoned nd cn possily e the results of the norml growth resulting from the technicl defects. Consequently; the found effects of ethylene eing involved in the effects of on the lterl root numer re interpreted with cution. This finding will for now e excluded from the conclusion of this report, ut will e kept in mind for next experiment. Roots of ein2-1 mutnts hd no ltered response to All the previously discussed prmeters of root responses showed no difference in the response of wild-type nd ein2-1 plnts to exposure (Appendix 6). Interestingly, the shoot re of ein2-1 plnts seemed to e less effected y exposure (Figure 17). Men shoot re (mm²) Col-0 Ein2-1 Figure 17: Men shoot re under exposure exposure (µm) Men shoot re (mm²) of wild-type A. thlin nd ein2-1 mutnts fter 6 dys of exposure (0µM 7.5 µm). No sttistics re presented since the dt only serve n indictionl purpose. This could imply tht EIN2 is involved in the -induced shoot responses, ut is not involved in induced root responses. Discussion on VAPs experiments All results hve to e confirmed y repetition of the experiments, to investigte whether the sme conclusion cn e formed. The experiment of ein2-1 hs to e repeted s the results my hve een influenced y the technicl prolems. Nevertheless, interesting differences etween wild-type nd ein2-1 mutnts were oserved. The primry root growth ws similrly inhiited y ech metl, therefore this prmeter is not likely to e, or specific. On the other hnd, the sme effect could still hve different moleculr sis, s oserved for the involvement of LOX1 in ut not in -induced primry root growth inhiition. 12 It should e kept in mind tht the findings in the mutnts re not solely resulting of the ctions of ABA nd ethylene signlling respectively, since mjor network of hormonl crosstlk is lso t work in these stress responses. Future test with tir1-1 nd coi1-1 mutnts my point to n involvement of uxin nd jsmonic cid signlling s well. In ll the different sections the results of the metl-specific effects on the men shoot re were given s well. These dt just give first ide out the reltion etween roots nd shoot responses ut they cnnot e used to drw ny conclusions, for now. A correltion etween the root nd shoot effects my e investigted in oth wild-types nd mutnts. 34

38 3.3 Gene expression nlysis in wild-type A. thlin In this experiment the gene expression of mrker genes (Tle 3) of hormonl signlling pthwys in wild-type A. thlin exposed to, nd ws exmined. Wild-type plnts were exposed for 1, 2 or 3 dys to 5µM, 5µM or 75 µm. The effect of the tretment ws exmined per exposure time (see elow). Dt re undled ccording to their nnottion (Tle 3). Becuse optimiztions of this experiment were mde, not every tretment group consisted of 6 smples. The numer of smples of the group,, nd respectively fter 1 dy of exposure were 4, 2, 4, 3; fter 2 dys of exposure were 5, 6, 4, 5; nd fter 3 dys of exposure were 6, 6, 6, 5. Ech smple contined 20 root systems. Although the numer of smples ws not consistent throughout the tretments, the results give good first indiction of the phytohormones involved. Also the dt from this experiment give n ide of the effect size in order to clculte the numer of smples tht is needed for next experiment with high sttisticl power. Optimiztion of gene expression on smll root systems Using smll root systems for RNA extrctions, the numer of hndlings tht cn cuse loss of RNA should e limited. The on-column DNse tretment ws shown to e insufficient when it ws performed ccording to the mnufcturer s mnul. Becuse the dditionl DNse tretment is very lour-intensive in this sort of experiment (lrge mount of smples), ut most importntly ecuse smll volume of the smple is lost in the removl of the DNse inhiitor, n optimiztion of the oncolumn DNse tretment is suggested. Since the smples of the roots re lredy very smll nd preferly lrge numer of genes re tested, it is est to minimize the volume loss. By incresing the volume of the DNse enzyme nd incresing the tretment period, the on-column DNse rection could eventully e sufficient. The normliztion ws performed using four reference genes. The used reference genes ll hd n verge expression stility (M-vlue) elow the cut-off vlue of M<1.5, proposed y Vndesompele et l. (2002) 47. The V-vlue (Pirwise vrition) ws lrger thn 0.15, suggesting tht the use of dditionl reference genes my give more optiml results. However in this experiment no extr reference genes could e tested ecuse the smples lcked sufficient volume. Results of the genes involved in jsmonte signlling The reltive expression levels of jsmonte-responsive genes re given in Figure 18, except for the LOX2 gene, ecuse it hs very low expression level in the roots, expression of this gene in most smples could not e detected. The expression of the LOX1 gene ws upregulted for ll tretments fter 1 dy of exposure, ut fter 2 nd 3 dys only cused upregultion. The LOX3 gene ws upregulted y nd fter 1 dy of exposure nd only y fter 2 dys. The only response of the LOX5 gene ws downregultion y fter 3 dys of exposure nd of the VSP2 gene n upregultion y fter 1 dy. nd tretments induced n upregultion of the MYC2 gene fter 3 dys. The POX gene ws upregulted y every exposure period of tretment nd y 1 dy of excess exposure. 35

39 A. B ,, Men reltive expression Men reltive gene expression 1, 2 nd 3 dys of exposure C. D. Men reltive gene expression 2.50,,c Men reltive gene expression E. 1, 2 nd 3 dys of exposure F. c , 1, 2 nd 3 dys of exposure,, 1, 2 nd 3 dys of exposure Men reltive gene expression , 2 nd 3 dys of exposure Men reltive gene expression ,,,c 1, 2 nd 3 dys of exposure c Figure 18: Gene expression of jsmonte responsive genes Men reltive expression level (normlized to the expression of four reference genes) of the (A.) LOX1 (B.) LOX3 (C.) LOX5 (D.) VSP2 (E.) MYC2 (F.) POX gene in wild-type A. thlin fter 1, 2 nd 3 dys of exposure to 5µM, 5µM or 75µM. Different letters indicte sttisticlly significnt differences within the exposure period (p<0.05), fter prmetric one-wy ANOVA nd Tukey (numer of smples: 0, 2, 4, 3, - 5, 6, 4, 5, - 6, 6, 6, 5, ech contining 20 root systems). Dys on which no letters re presented did not find ny significnt differences. If the originl dt were not normlly distriuted the prmetric one-wy ANOVA nd Tukey were performed on trnsformed dt mtrix: logrithmic mtrix for 1 dy exposed LOX1, LOX3, VSP2, POX nd for 3 dys exposed VSP2, nd squre root mtrix for 2 dys exposed LOX3. 36

40 Results of the genes involved in ethylene signlling In the gene expression of ERS1, ERS2 nd ETR2, no effect ws detected fter 1 dy of exposure nd fter oth 2 nd 3 dys nd tretments resulted in n upregultion for every gene. The ERF1 gene ws only upregulted y, in every exposure period. (Figure 19) A. B Men reltive gene expression 1, 2 nd 3 dys of exposure C. D. Men reltive gene expression ,, 1, 2 nd 3 dys of exposure c Men reltive gene expression 1, 2 nd 3 dys of exposure ,, Men reltive gene expression,, 1, 2 nd 3 dys of exposure c Figure 19: Gene expression of ethylene responsive genes Men reltive expression level (normlized to the expression of four reference genes) of the (A.) ERS1 (B.) ERS2 (C.) ERF1 (D.) ETR2 gene. in wild-type A. thlin fter 1, 2 nd 3 dys of exposure to 5µM, 5µM or 75µM. Different letters indicte sttisticlly significnt differences within the exposure period (p<0.05), fter prmetric one-wy ANOVA nd Tukey (numer of smples: 0, 2, 4, 3, - 5, 6, 4, 5, - 6, 6, 6, 5, ech contining 20 root systems). Dys on which no letters re presented did not find ny significnt differences. If the originl dt were not normlly distriuted the prmetric one-wy ANOVA nd Tukey were performed on trnsformed dt mtrix: logrithmic mtrix for 3 dys exposed ERS1, ERS2 nd for ERF1 (1 nd 2 dys exposed), nd squre root mtrix for 3 dys exposed ERF1. Results of the genes involved in uxin signlling The NAC1 gene ws uregulted y tretment fter 3 dys of exposure. nd oth cused for every exposure period n upregultion in the NAC2 gene. The DBP gene ws downregulted y tretment fter 2 nd 3 dys. The IAA19 nd AIR12 were oth upregulted y for ech exposure period (except 1 dy AIR12 hd no effects). (Figure 20) 37

41 A. B Men reltive gene expression 1, 2 nd 3 dys of exposure C. D ,, Men reltive gene expression E. Men reltive gene expression 2.50,, 1, 2 nd 3 dys of exposure 1, 2 nd 3 dys of exposure Men reltive gene expression Men reltive gene expression , 2 nd 3 dys of exposure, 1, 2 nd 3 dys of exposure c c Figure 20: Gene expression of uxin responsive genes Men reltive expression level (normlized to the expression of four reference genes) of the (A.) NAC1 (B.) NAC2 (C.) DBP (D.) IAA19 (E.) AIR12 gene in wild-type A. thlin fter 1, 2 nd 3 dys of exposure to 5µM, 5µM or 75µM. Different letters indicte sttisticlly significnt differences within the exposure period (p<0.05), fter prmetric one-wy ANOVA nd Tukey (numer of smples: 0, 2, 4, 3, - 5, 6, 4, 5, - 6, 6, 6, 5, ech contining 20 root systems). Dys on which no letters re presented did not find ny significnt differences. If the originl dt were not normlly distriuted the prmetric one-wy ANOVA nd Tukey were performed on trnsformed dt mtrix: logrithmic mtrix for 3 dys exposed DBP, IAA19 nd AIR12. The sttistics of 2 dys exposed NAC2 expression were found y non-prmetric Kruskl-Wllis test nd Pirwise Wilcoxon rnk sum test. 38

42 Results of the genes involved in ABA signlling The expression of the ABI5 gene ws upregulted y 1 nd 3 dys of exposure. No chnges were detected in the expression of the ABI8 gene. A. B. Men reltive gene expression , 1, 2 nd 3 dys of exposure, Men reltive gene expression , 2 nd 3 dys of exposure Figure 21: Gene expression of ABA responsive genes Men reltive expression level (normlized to the expression of four reference genes) of the (A.) ABI5 (B.) ABI8 gene in wild-type A. thlin fter 1, 2 nd 3 dys of exposure to 5µM, 5µM or 75µM. Different letters indicte sttisticlly significnt differences within the exposure period (p<0.05), fter prmetric onewy ANOVA nd Tukey (numer of smples: 0, 2, 4, 3, - 5, 6, 4, 5, - 6, 6, 6, 5, ech contining 20 root systems). Dys on which no letters re presented did not find ny significnt differences. All significnt differences were found using untrnsformed dt. Discussion on gene-expression experiment The effects of metl exposure on the expression of mrker genes of the phytohormones signlling pthwys in wild-type root systems give good first impression on the involvement of the different phytohormones involved in metl-specific root responses. The results of the experiment re plced together with the oservtions of the VAPs experiments nd re summrised in Tle 4. Tle 4: Summry of the gene-expression nd VAPs experiments Auxin ABA Jsmontes 1 Ethylene i4-1 ein2-1 NAC2 ABI5 LOX1 ERS1 Lterl root DBP IAA19 LOX3 LOX5 ERS2 ERF1 elongtion AIR12 POX ETR2 NAC2 LOX1 Lterl LOX5 VSP2 root elongtion MYC2 NAC1 NAC2 LOX1 POX MYC2 ERS1 ERS2 ETR2 Lterl root numer Lterl root elongtion 1 LOX1, LOX5 nd POX re 9-LOX responsive, LOX2 nd LOX3 re 13-LOX responsive. 39

43 The results of the gene expression nlysis in wild-type A. thlin show tht the different metls induce severl genes tht re responsive to different phytohormones. Interestingly hd no effect on the tested ethylene responsive genes, ut did induce different response in the ethylene-insensitive mutnt thn in the wild-type. ws the only metl tht induced ltered root systems (compred to the wild-type) in oth the studied mutnts, while only ffected i4-1 nd ein2-1. The effects of on the root system of i4-1 nd of nd on the root system of ein2-1 were excreted in the elongtion, rther thn lterl root numer. The effects on lterl root numer only different from the wild-type in -stressed i4-1. As in the VAPs experiments, repetition of the experiment is needed nd will lso hve to e performed on mutnts to llow more detiled exmintion nd interprettion. Becuse the expression of uxin nd jsmontes-responsive genes ws ffected in the wild-type, experiments with tir1-1 nd coi1-1 cn possily fill the lnks of the prmeters involved in, nd -specific ltered root systems. 40

44 4 Conclusion The effects of, nd were studied on the root system. nd re essentil elements, while is non-essentil. Becuse is non-essentil it is toxic even t very low levels. The studied responses of the roots cn e divided into primry root growth, lterl root growth nd numer of lterl roots. The primry root growth ws similrly inhiited y ech metl, therefore this prmeter is not likely to e, or specific. The results leding to the formed hypothesis re summrized in Figure 22. From the results of the -specific root responses it cn e concluded tht ABA-signlling through ABI4 is involved in the metl-specific lterl root elongtion response. The lterl root elongtion ws ffected more y in the i4-1 mutnt thn it ws in the wild-type. Also, ABAresponsive genes were upregulted in wild-type plnts fter tretment. The results of the VAPs experiments indicte tht EIN2 is not involved in -specific root responses, lthough exposure did induce the expression of ethylene responsive genes. Possily ethylene is involved in shoot specific responses to, s the men shoot re of the ein2-1 mutnt were lso found to e lower thn of the wild-type. No ltertions in the -specific effect on lterl root numer were found. Since tretment could lter the gene expression of uxin nd jsmontes responsive genes, further test with tir1-1 nd coi1-1 could mye identify the pthwy involved in -specific effects on lterl root numer. Also for, only specific effects on the lterl root elongtion were found nd further testing with tir1-1 nd coi1-1 re needed for more informtion. The ethylene pthwy ws found to e involved in - specific responses in lterl root elongtion. The lterl roots of ein2-1 were shorter tht the lterl roots of the wild-type under stress. tretments did not lter the geneexpression of ethylene responsive genes in the wild-type. For more insights in the involvement of ethylene in -specific lterl root growth ltertion, lrger numer of ethylene responsive genes needs to e tested in wild-type, s well s in ein2-1 mutnts. Stress y excess ws found to e ABA-medited for the -specific effects on lterl root numer nd ethylene-medited for the -specific ltered lterl root growth. The numer of lterl roots in i4-1 mutnts ws significntly higher thn in wild-type plnts under stress. This leds to the hypothesis tht the -specific switch off effect is ABA-medited. -specific effects on lterl root elongtion involve the ethylene signlling pthwy, since the lterl lengths in ein2-1 mutnts were shorter under tretment thn in the wild-type. In the gene-expression experiment on the wild-type ws found to upregulte oth ABA nd ethylene responsive genes. 41

45 42 Figure 22: Schemtic representtion of results supporting the formed hypotheses

46 Future perspectives As lredy mentioned in the discussion, the findings hve to e confirmed y repetition. A numer of improvements were mde over the course of the experiments, fcilitting future experiments. However the on-column DNse tretment in the gene expression experiment needs to e djusted. In the used set-up, the gene-expression ws mesured on homogenous root smple. However, in vivo the expression of different genes is sptiotemporl dependent. If the gene expression nlysis cn e further optimized for the lredy smll smples, mye it will ecome possile to mesure the expression in distinct regions of the root to provide n interprettion tht corresponds more to the expression in the root. A correltion etween the root nd shoot responses cn lso e mde, s lredy mentioned in the discussion. When the metl specific responses of the root re etter understood, next step is to investigte the responses in to heterogeneous metl exposure. This experimentl set-up resemles the effect in the field more, ut will lso e n interesting sset to compre the findings with the homogenous exposure. Ultimtely, predictions of how the root system cn e mnipulted y phytohormones to grow optimlly in contminted soil cn e tested. For testing in the field, for phytoremedition purposes the root system hs to colonize the contminted ptches. However, this coloniztion hs to e in lnce with the plnts tolernce nd survivl. In order to void using geneticlly modified orgnisms on field ppliction, the results cn e reproduced using cteri producing phytohormones. The results cn e extrpolted to crop species like Brssic npus, ecuse it is closely relted to A. thlin. 43

47

48 References 1. Godfry, H. C. J. et l. Food security: the chllenge of feeding 9 illion people. Science (New York, N.Y.) 327, (2010). 2. Khush, G. S. Green revolution: the wy forwrd. Nture reviews. Genetics 2, (2001). 3. Den Herder, G., Vn Isterdel, G., Beeckmn, T. & De Smet, I. The roots of new green revolution. Trends in plnt science 15, (2010). 4. Péret, B. et l. Aridopsis lterl root development: n emerging story. Trends in plnt science 14, (2009). 5. Petrick, J. J., Winter, C. M. & Benfey, P. N. Control of Aridopsis root development. Annul review of plnt iology 63, (2012). 6. Frnco, J., Bñón, S. & Vicente, M. Root development in horticulturl plnts grown under iotic stress conditions A review. Journl of Horticulturl 86, (2011). 7. Gison, S. I. Sugr nd phytohormone response pthwys: nvigting signlling network. Journl of experimentl otny 55, (2004). 8. Keller, C., Hmmer, D., Kyser, A. & Richner, W. Root development nd hevy metl phytoextrction efficiency: comprison of different plnt species in the field. Plnt nd Soil (2003) 9. Eissenstt, D. M., Wells, C. E., Yni, R. D. & Whiteck, J. L. Building roots in chnging environment: implictions for root longevity. New Phytologist 147, (2000). 10. Cmpell, B. & Grime, J. A new method of exposing developing root systems to led ptchiness in minerl nutrient supply. Annls of Botny (1989). 11. Potters, G., Psternk, T. P., Guisez, Y. & Jnsen, M. K. Different stresses, similr morphogenic responses: integrting plethor of pthwys. Plnt, cell & environment 32, (2009). 12. Remns, T. et l. Understnding the development of roots exposed to contminnts nd the potentil of plntssocited cteri for optimiztion of growth. Annls of otny 110, (2012). 13. Krouk, G. et l. A frmework integrting plnt growth with hormones nd nutrients. Trends in plnt science 16, (2011). 14. Glvn-Ampudi, C. S. & Testerink, C. Slt stress signls shpe the plnt root. rrent opinion in plnt iology 14, (2011). 15. De Smet, I. et l. An scisic cid-sensitive checkpoint in lterl root development of Aridopsis. The Plnt journl : for cell nd moleculr iology 33, (2003). 16. De Smet, I., Zhng, H., Inzé, D. & Beeckmn, T. A novel role for scisic cid emerges from underground. Trends in plnt science 11, (2006). 17. Benková, E. et l. Locl, efflux-dependent uxin grdients s common module for plnt orgn formtion. Cell 115, (2003). 18. Fukki, H., Okushim, Y. & Tsk, M. Auxin-medited lterl root formtion in higher plnts. Interntionl review of cytology 256, (2007). 19. Fukki, H. & Tsk, M. Hormone interctions during lterl root formtion. Plnt moleculr iology 69, (2009). 20. Ry-González, J., Pelgio-Flores, R. & López-Bucio, J. The jsmonte receptor COI1 plys role in jsmonteinduced lterl root formtion nd lterl root positioning in Aridopsis thlin. Journl of plnt physiology 169, (2012). 21. Piotrowsk-Niczyporuk, A., Bjguz, A., Zmrzyck, E. & Godlewsk-Żyłkiewicz, B. Phytohormones s regultors of hevy metl iosorption nd toxicity in green lg Chlorell vulgris (Chlorophycee). Plnt physiology nd iochemistry : PPB / Société frnçise de physiologie végétle 52, (2012). 22. Eloeid, M. Physiology of uxin in response to environmentl stress nd hevy metl pollution. (2008). 45

49 23. Lehoti, N. et l. Selenite-induced hormonl nd signlling mechnisms during root growth of Aridopsis thlin L. Journl of experimentl otny 63, (2012). 24. Zoll, G., Heimer, Y. M. & Brk, S. Mild slinity stimultes stress-induced morphogenic response in Aridopsis thlin roots. Journl of experimentl otny 61, (2010). 25. Snz, L., Murry, J. A. H. & Dewitte, W. To Divide nd to Rule; Regulting Cell Division in Roots During Postemryonic Growth. Progress in Botny 73, (2012). 26. Benková, E. & Bielch, A. Lterl root orgnogenesis - from cell to orgn. rrent opinion in plnt iology 13, (2010). 27. Osmont, K. S., Siout, R. & Hrdtke, C. S. Hidden rnches: developments in root system rchitecture. Annul review of plnt iology 58, (2007). 28. Hoffmnn, M., Hentrich, M. & Pollmnn, S. Auxin-oxylipin crosstlk: reltionship of ntgonists. Journl of integrtive plnt iology 53, (2011). 29. Mlmy, J. E. Intrinsic nd environmentl response pthwys tht regulte root system rchitecture. Plnt, cell & environment 28, (2005). 30. Bli, V. & Devoto, A. Jsmonte signlling network in Aridopsis thlin: crucil regultory nodes nd new physiologicl scenrios. The New phytologist 177, (2008). 31. De Smet, I., Vnneste, S., Inzé, D. & Beeckmn, T. Lterl root initition or the irth of new meristem. Plnt moleculr iology 60, (2006). 32. Kepinski, S. & Leyser, O. The Aridopsis F-ox protein TIR1 is n uxin receptor. Nture 435, (2005). 33. Alonso, J. M., Hirym, T., Romn, G., Nourizdeh, S. & Ecker, J. R. EIN2, ifunctionl trnsducer of ethylene nd stress responses in Aridopsis. Science (New York, N.Y.) 284, (1999). 34. Mrkkis, M. N. et l. Identifiction of genes involved in the ACC-medited of root cell elongtion in Aridopsis thlin. BMC plnt iology 12, 208 (2012). 35. Adms, E. & Turner, J. COI1, jsmonte receptor, is involved in ethylene-induced inhiition of Aridopsis root growth in the light. Journl of experimentl otny 61, (2010). 36. Cot, C., Gllego, B., Mrtos, S., Brceló, J. & Poschenrieder, C. Signl cross tlk in Aridopsis exposed to cdmium, silicon, nd Botrytis cinere. Plnt 237, (2013). 37. Komrink, E. Chemicl nd genetic explortion of jsmonte iosynthesis nd signling pths. Plnt 236, (2012). 38. Sntner, A. & Estelle, M. The uiquitin-protesome system regultes plnt hormone signling. The Plnt journl : for cell nd moleculr iology 61, (2010). 39. Chen, R. et l. The Aridopsis meditor suunit MED25 differentilly regultes jsmonte nd scisic cid signling through intercting with the MYC2 nd ABI5 trnscription fctors. The Plnt cell 24, (2012). 40. Ppdi, C., Joseph, M. P., Slmó, I. P., Vidl, S. & Szdos, L. Genetic technologies for the identifiction of plnt genes ling environmentl stress responses. Functionl Plnt Biology 36, 696 (2009). 41. Kepinski, S. Integrting hormone signling nd ptterning mechnisms in plnt development. rrent opinion in plnt iology 9, (2006). 42. Xie, Q. Aridopsis NAC1 trnsduces uxin signl downstrem of TIR1 to promote lterl root development. Genes & Development 14, (2000). 43. De Dorlodot, S. et l. Root system rchitecture: opportunities nd constrints for genetic improvement of crops. Trends in plnt science 12, (2007). 44. Sun, J. et l. Aridopsis ASA1 is importnt for jsmonte-medited regultion of uxin iosynthesis nd trnsport during lterl root formtion. The Plnt cell 21, (2009). 45. Suter,, Dvies, W. J. & Hrtung, W. The long-distnce scisic cid signl in the droughted plnt: the fte of the hormone on its wy from root to shoot. Journl of experimentl otny 52, (2001). 46

50 46. Pfffl, M., Tichopd, A., Progomet, C. & Neuvins, T. Determintion of stle housekeeping genes, differentilly regulted trget genes nd smple integrity : BestKeeper-Excel-sed tool using pir-wise correltions. Biotechnol Lett 26, (2004). 47. Vndesompele J, De Preter K, Pttyn F, Poppe B, Vn Roy N, De Pe- pe A, S. F. Accurte normlistion of reltime quntittive RT-PCR dt y geometric verging of multiple internl genes. Genome Biol 3, reserch (2002). 48. Remns, T. et l. Normlistion of rel-time RT-PCR gene expression mesurements in Aridopsis thlin exposed to incresed metl concentrtions. Plnt 227, (2008). 49. López, M. et l. Antgonistic role of 9-lipoxygense-derived oxylipins nd ethylene in the of oxidtive stress, lipid peroxidtion nd plnt defence. The Plnt journl : for cell nd moleculr iology 67, (2011). 50. Vellosillo, T. et l. Oxylipins produced y the 9-lipoxygense pthwy in Aridopsis regulte lterl root development nd defense responses through specific signling cscde. The Plnt cell 19, (2007). 51. He, X.-J. et l. AtNAC2, trnscription fctor downstrem of ethylene nd uxin signling pthwys, is involved in slt stress response nd lterl root development. The Plnt journl : for cell nd moleculr iology 44, (2005). 52. Xu, K. et l. A genome-wide trnscriptome profiling revels the erly moleculr events during cllus initition in Aridopsis multiple orgns. Genomics 100, (2012). 53. Alliotte, T. et l. An Auxin-Regulted Gene of Aridopsis thlin Encodes DNA-Binding Protein. Plnt physiology 89, (1989). 54. Neuteoom, L. W. et l. Isoltion nd chrcteriztion of cdna clones corresponding with mrnas tht ccumulte during uxin-induced lterl root formtion. Plnt moleculr iology 39, (1999). 55. Seo, P. J. et l. The MYB96 trnscription fctor medites scisic cid signling during drought stress response in Aridopsis. Plnt physiology 151, (2009). 56. R Development Core Tem R: A lnguge nd environment for sttisticl computing. R Foundtion for Sttisticl Computing, Vienn, Austri. ISBN (2008). 47

51

52 Appendix Appendix 1 - Phusion Hot Strt II High-Fidelity DNA Polymerse (Thermo scientific) i

53 ii Appendix 2 - Nucleospin RNA XS kit (Mchery-Ngel)

54 iii